# iM-Seeker
iM-Seeker is commandline software designed to predict DNA i-Motif folding status and folding strength.
Details can be found at https://github.com/YANGB1/iM-Seeker
# Installation and Usage
The dependency packages can be installed by:
```
pip3 install -r requirements.txt
```
iM-Seeker can be installed by:
```
pip3 install iM-Seeker
```
Alternatively, the python script 'iM-Seeker.py' can be downloaded directly from Github. The stored directory can be added to the ‘PATH’ environmental variable or the scripts with full path can be run alternatively using command like:
```
python3 iM-Seeker.py -h
```
**Please pay attention !!!!!! The program needs two models 'pickle_model_classification.pkl' and 'pickle_model_regression.pkl' which are required as the input files of the software. Please find all the files at https://figshare.com/s/e4e72e2e8ceaa0a4fbd6, where all these files can be downloaded directly.**
After intalled the package with 'pip',the help page can be checked by following command:
```
iM-Seeker.py -h
```
Parameters can be configured according to the user's own needs. Here is an example:
```
iM-Seeker.py --sequence input.fa --classification_model pickle_model_classification.pkl --regression_model pickle_model_regression.pkl --overlapped 2 --greedy 2 --stem_short 3 --stem_long 5 --loop1_short 1 --loop1_long 12 --loop2_short 1 --loop2_long 12 --loop3_short 1 --loop3_long 12 --representative_conformation 2 --output_folder output_path
```
# Input and output
The input sequences should be in fasta formation, for instance:
\>test1
CCCTCCCCCTCCCCTCCCTCCCCCCCCTCCCCTCCCTCCCTCCCCCCCCTCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCCCCCCTCCTCCCCTCCCCCTCCCCTCCCTCCCTCC
\>test2
CCCCCTCCCCCTCCCCCTCCCCCTCCCCC
\>test3
CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
\>test4
CCCCGACCCCAACCCCTCCCCCAACCCCTCCCC
The output files are stored in the pre-set output folder.
If --representative_conformation is set as 1, 'iM-seeker_result_average_conformation.txt' includes conformation A of pre-set iM structures.
If --representative_conformation is set as 2, 'iM-seeker_result_side_shorter_conformation.txt' includes conformation B of pre-set iM structures.
The prediction result is kept in 'iM-seeker_final_prediction.txt'.
"0" of folding status means unfolded while "1" means folded. Folding strength is a continuous number.
Raw data
{
"_id": null,
"home_page": "https://github.com/YANGB1/iM-Seeker",
"name": "iM-Seeker",
"maintainer": "",
"docs_url": null,
"requires_python": "",
"maintainer_email": "",
"keywords": "",
"author": "Bibo Yang",
"author_email": "biboy5032@gmail.com",
"download_url": "https://files.pythonhosted.org/packages/57/f7/9d2b411499d2d6dcc36c31ebae789ed1027a6a3eb3db889d9052b1c63eb8/iM-Seeker-1.0.14.tar.gz",
"platform": null,
"description": "# iM-Seeker\r\n\r\niM-Seeker is commandline software designed to predict DNA i-Motif folding status and folding strength.\r\nDetails can be found at https://github.com/YANGB1/iM-Seeker\r\n\r\n# Installation and Usage\r\nThe dependency packages can be installed by:\r\n``` \r\npip3 install -r requirements.txt\r\n``` \r\niM-Seeker can be installed by:\r\n``` \r\npip3 install iM-Seeker\r\n```\r\nAlternatively, the python script 'iM-Seeker.py' can be downloaded directly from Github. The stored directory can be added to the \u2018PATH\u2019 environmental variable or the scripts with full path can be run alternatively using command like: \r\n``` \r\npython3 iM-Seeker.py -h\r\n``` \r\n**Please pay attention !!!!!! The program needs two models 'pickle_model_classification.pkl' and 'pickle_model_regression.pkl' which are required as the input files of the software. Please find all the files at https://figshare.com/s/e4e72e2e8ceaa0a4fbd6, where all these files can be downloaded directly.**\r\n \r\nAfter intalled the package with 'pip',the help page can be checked by following command:\r\n``` \r\niM-Seeker.py -h\r\n``` \r\nParameters can be configured according to the user's own needs. Here is an example:\r\n``` \r\niM-Seeker.py --sequence input.fa --classification_model pickle_model_classification.pkl --regression_model pickle_model_regression.pkl --overlapped 2 --greedy 2 --stem_short 3 --stem_long 5 --loop1_short 1 --loop1_long 12 --loop2_short 1 --loop2_long 12 --loop3_short 1 --loop3_long 12 --representative_conformation 2 --output_folder output_path\r\n``` \r\n\r\n# Input and output\r\nThe input sequences should be in fasta formation, for instance:\r\n\r\n\\>test1\r\n\r\nCCCTCCCCCTCCCCTCCCTCCCCCCCCTCCCCTCCCTCCCTCCCCCCCCTCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCCCCCCTCCTCCCCTCCCCCTCCCCTCCCTCCCTCC\r\n\r\n\\>test2\r\n\r\nCCCCCTCCCCCTCCCCCTCCCCCTCCCCC\r\n\r\n\\>test3\r\n\r\nCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC\r\n\r\n\\>test4\r\n\r\nCCCCGACCCCAACCCCTCCCCCAACCCCTCCCC\r\n\r\nThe output files are stored in the pre-set output folder.\r\n\r\nIf --representative_conformation is set as 1, 'iM-seeker_result_average_conformation.txt' includes conformation A of pre-set iM structures. \r\n\r\nIf --representative_conformation is set as 2, 'iM-seeker_result_side_shorter_conformation.txt' includes conformation B of pre-set iM structures. \r\n\r\nThe prediction result is kept in 'iM-seeker_final_prediction.txt'.\r\n\r\n\"0\" of folding status means unfolded while \"1\" means folded. Folding strength is a continuous number. \r\n",
"bugtrack_url": null,
"license": "",
"summary": "iM-Seeker is commandline software designed to predict DNA i-Motif folding status and folding strength.",
"version": "1.0.14",
"project_urls": {
"Homepage": "https://github.com/YANGB1/iM-Seeker"
},
"split_keywords": [],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "57f79d2b411499d2d6dcc36c31ebae789ed1027a6a3eb3db889d9052b1c63eb8",
"md5": "ad88a1b5674b61153bb50fbaab5ed464",
"sha256": "028afa626cde34802338a91a7c276de5c6f139844ebe936f564529707a5b40d3"
},
"downloads": -1,
"filename": "iM-Seeker-1.0.14.tar.gz",
"has_sig": false,
"md5_digest": "ad88a1b5674b61153bb50fbaab5ed464",
"packagetype": "sdist",
"python_version": "source",
"requires_python": null,
"size": 11258,
"upload_time": "2024-01-18T16:23:42",
"upload_time_iso_8601": "2024-01-18T16:23:42.984333Z",
"url": "https://files.pythonhosted.org/packages/57/f7/9d2b411499d2d6dcc36c31ebae789ed1027a6a3eb3db889d9052b1c63eb8/iM-Seeker-1.0.14.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2024-01-18 16:23:42",
"github": true,
"gitlab": false,
"bitbucket": false,
"codeberg": false,
"github_user": "YANGB1",
"github_project": "iM-Seeker",
"travis_ci": false,
"coveralls": false,
"github_actions": false,
"requirements": [
{
"name": "imbalanced_learn",
"specs": [
[
">=",
"0.11.0"
]
]
},
{
"name": "imblearn",
"specs": [
[
">=",
"0.0"
]
]
},
{
"name": "numpy",
"specs": [
[
">=",
"1.22.4"
]
]
},
{
"name": "regex",
"specs": [
[
">=",
"2021.11.10"
]
]
},
{
"name": "xgboost",
"specs": [
[
">=",
"1.7.6"
]
]
}
],
"lcname": "im-seeker"
}
JSON
