# ResBlaster
```
____ ____ _ _
| _ \ ___ ___| __ )| | __ _ ___| |_ ___ _ __
| |_) / _ \/ __| _ \| |/ _` / __| __/ _ \ '__|
| _ < __/\__ \ |_) | | (_| \__ \ || __/ |
|_| \_\___||___/____/|_|\__,_|___/\__\___|_|
```
## Installation
```shell
pip3 install ResBlaster
```
## Dependency
* BLAST+ >2.7.0
* cvmblaster (v0.4.1)
**you should add BLAST in your PATH**
## Blast installation
### Windows
Following this tutorial: [Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)
### Linux/Mac
The easyest way to install blast is:
```shell
conda install -c bioconda blast
```
## Usage
### 1. Initialize reference database
After finish installation, you should first initialize the reference database using following command
```shell
ResBlaster init
```
```shell
Usage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory>
Author: Qingpo Cui(SZQ Lab, China Agricultural University)
optional arguments:
-h, --help show this help message and exit
-i I <input_path>: the PATH to the directory of assembled genome files
-o O <output_directory>: output PATH
-db DB <database>: resfinder or others, You colud check database list using -list parameter
-minid MINID <minimum threshold of identity>, default=90
-mincov MINCOV <minimum threshold of coverage>, default=60
-t T <number of threads>: default=8
-store_arg_seq <save the nucleotide and amino acid sequence of find genes on genome>
-v, --version <display version>
-updatedb UPDATEDB <add input fasta to BLAST database>
-init <initialize the reference database>
ResBlaster subcommand:
{show_db,init,updatedb}
show_db <show the list of all available database>
init <initialize the reference database>
updatedb <add custome database, use ResBlaster updatedb -h for help>
```
### 2. Making your own database
Let's say you want to make your own database called `owndb`. All you need is a FASTA file of nucleotide sequences, say `owndb.fsa`(**note: the fasta file must end with .fsa**). Ideally the sequence IDs would have the format `>GENE___ID___ACC___CATEGORY` where `GENE` is the name of `GENE`, `ID` is the `allele ID` of `GENE`, `ACC` is an accession number of the sequence source, `CATEGORY` is the `CATEGORY of this GENE belongs to`.
**Your final** `owndb.fsa` should like this:
```shell
>blaOXA-62___1___AY423074___Beta-lactam
ATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG
GTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA
GCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC
GTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC
GCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG
GCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG
CGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC
CTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG
AACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC
GACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC
ACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC
ACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC
GGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC
GACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG
GACCTGAAGCTGATCTGA
```
**Run following command will add** `owndb.fsa` to blast database
```shell
ResBlaster -updatedb owndb.fsa
```
Raw data
{
"_id": null,
"home_page": "https://github.com/hbucqp/ResBlaster",
"name": "ResBlaster",
"maintainer": null,
"docs_url": null,
"requires_python": null,
"maintainer_email": null,
"keywords": "pip, wgs, blastn, amr",
"author": "Qingpo Cui",
"author_email": "cqp@cau.edu.cn",
"download_url": "https://files.pythonhosted.org/packages/6c/aa/7ec9490e26f0a2919a4035bb67374df46fc5296020f23526d13e0fe43969/ResBlaster-0.4.3.tar.gz",
"platform": "any",
"description": "# ResBlaster\n\n\n\n\n```\n ____ ____ _ _\n| _ \\ ___ ___| __ )| | __ _ ___| |_ ___ _ __\n| |_) / _ \\/ __| _ \\| |/ _` / __| __/ _ \\ '__|\n| _ < __/\\__ \\ |_) | | (_| \\__ \\ || __/ |\n|_| \\_\\___||___/____/|_|\\__,_|___/\\__\\___|_|\n\n```\n\n## Installation\n```shell\npip3 install ResBlaster\n```\n\n## Dependency\n\n* BLAST+ >2.7.0\n\n* cvmblaster (v0.4.1)\n\n**you should add BLAST in your PATH**\n\n## Blast installation\n\n### Windows\n\nFollowing this tutorial: [Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)\n\n### Linux/Mac\n\nThe easyest way to install blast is:\n```shell\nconda install -c bioconda blast\n```\n\n## Usage\n\n### 1. Initialize reference database\n\nAfter finish installation, you should first initialize the reference database using following command\n```shell\nResBlaster init\n```\n\n```shell\nUsage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory>\n\nAuthor: Qingpo Cui(SZQ Lab, China Agricultural University)\n\noptional arguments:\n -h, --help show this help message and exit\n -i I <input_path>: the PATH to the directory of assembled genome files\n -o O <output_directory>: output PATH\n -db DB <database>: resfinder or others, You colud check database list using -list parameter\n -minid MINID <minimum threshold of identity>, default=90\n -mincov MINCOV <minimum threshold of coverage>, default=60\n -t T <number of threads>: default=8\n -store_arg_seq <save the nucleotide and amino acid sequence of find genes on genome>\n -v, --version <display version>\n -updatedb UPDATEDB <add input fasta to BLAST database>\n -init <initialize the reference database>\n\nResBlaster subcommand:\n {show_db,init,updatedb}\n show_db <show the list of all available database>\n init <initialize the reference database>\n updatedb <add custome database, use ResBlaster updatedb -h for help>\n\n\n```\n### 2. Making your own database\n\nLet's say you want to make your own database called `owndb`. All you need is a FASTA file of nucleotide sequences, say `owndb.fsa`(**note: the fasta file must end with .fsa**). Ideally the sequence IDs would have the format `>GENE___ID___ACC___CATEGORY` where `GENE` is the name of `GENE`, `ID` is the `allele ID` of `GENE`, `ACC` is an accession number of the sequence source, `CATEGORY` is the `CATEGORY of this GENE belongs to`.\n\n**Your final** `owndb.fsa` should like this:\n```shell\n>blaOXA-62___1___AY423074___Beta-lactam\nATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG\nGTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA\nGCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC\nGTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC\nGCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG\nGCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG\nCGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC\nCTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG\nAACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC\nGACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC\nACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC\nACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC\nGGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC\nGACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG\nGACCTGAAGCTGATCTGA\n```\n**Run following command will add** `owndb.fsa` to blast database\n\n```shell\nResBlaster -updatedb owndb.fsa\n```\n\n\n\n\n",
"bugtrack_url": null,
"license": "MIT Licence",
"summary": "find antimcirobial resistance genes on genomes",
"version": "0.4.3",
"project_urls": {
"Homepage": "https://github.com/hbucqp/ResBlaster"
},
"split_keywords": [
"pip",
" wgs",
" blastn",
" amr"
],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "c4e5762b66ef24778faa380d667d5c56380acd03bf74dd216c3dd97385cef989",
"md5": "351d9fb421364b32311cec3d529b9460",
"sha256": "af00181b78200ad3aa4eb2c6d39242e17fad956379d4499de0fbfbc08ac9ea8a"
},
"downloads": -1,
"filename": "ResBlaster-0.4.3-py3-none-any.whl",
"has_sig": false,
"md5_digest": "351d9fb421364b32311cec3d529b9460",
"packagetype": "bdist_wheel",
"python_version": "py3",
"requires_python": null,
"size": 20578374,
"upload_time": "2024-10-09T11:09:24",
"upload_time_iso_8601": "2024-10-09T11:09:24.559200Z",
"url": "https://files.pythonhosted.org/packages/c4/e5/762b66ef24778faa380d667d5c56380acd03bf74dd216c3dd97385cef989/ResBlaster-0.4.3-py3-none-any.whl",
"yanked": false,
"yanked_reason": null
},
{
"comment_text": "",
"digests": {
"blake2b_256": "6caa7ec9490e26f0a2919a4035bb67374df46fc5296020f23526d13e0fe43969",
"md5": "7e2587a5a55f635f054de3c16238b0fb",
"sha256": "6eeac598d5d3797ad1f2664c6cbfbf1c6d4b5ed76a7472e16c6e07b0d1ec907f"
},
"downloads": -1,
"filename": "ResBlaster-0.4.3.tar.gz",
"has_sig": false,
"md5_digest": "7e2587a5a55f635f054de3c16238b0fb",
"packagetype": "sdist",
"python_version": "source",
"requires_python": null,
"size": 19057374,
"upload_time": "2024-10-09T11:09:28",
"upload_time_iso_8601": "2024-10-09T11:09:28.867845Z",
"url": "https://files.pythonhosted.org/packages/6c/aa/7ec9490e26f0a2919a4035bb67374df46fc5296020f23526d13e0fe43969/ResBlaster-0.4.3.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2024-10-09 11:09:28",
"github": true,
"gitlab": false,
"bitbucket": false,
"codeberg": false,
"github_user": "hbucqp",
"github_project": "ResBlaster",
"travis_ci": false,
"coveralls": false,
"github_actions": false,
"requirements": [
{
"name": "Bio",
"specs": [
[
"==",
"1.7.1"
]
]
},
{
"name": "cvmblaster",
"specs": [
[
"==",
"0.4.3"
]
]
},
{
"name": "cvmcore",
"specs": [
[
"==",
"0.1.7"
]
]
},
{
"name": "pandas",
"specs": [
[
"==",
"1.4.0"
]
]
},
{
"name": "setuptools",
"specs": [
[
"==",
"58.1.0"
]
]
},
{
"name": "tabulate",
"specs": [
[
"==",
"0.9.0"
]
]
}
],
"lcname": "resblaster"
}
JSON
