ResBlaster


NameResBlaster JSON
Version 0.4.3 PyPI version JSON
download
home_pagehttps://github.com/hbucqp/ResBlaster
Summaryfind antimcirobial resistance genes on genomes
upload_time2024-10-09 11:09:28
maintainerNone
docs_urlNone
authorQingpo Cui
requires_pythonNone
licenseMIT Licence
keywords pip wgs blastn amr
VCS
bugtrack_url
requirements Bio cvmblaster cvmcore pandas setuptools tabulate
Travis-CI No Travis.
coveralls test coverage No coveralls.
            # ResBlaster

![PYPI](https://img.shields.io/pypi/v/ResBlaster)
![Static Badge](https://img.shields.io/badge/OS-_Windows_%7C_Mac_%7C_Linux-steelblue)

```
 ____           ____  _           _
|  _ \ ___  ___| __ )| | __ _ ___| |_ ___ _ __
| |_) / _ \/ __|  _ \| |/ _` / __| __/ _ \ '__|
|  _ <  __/\__ \ |_) | | (_| \__ \ ||  __/ |
|_| \_\___||___/____/|_|\__,_|___/\__\___|_|

```

## Installation
```shell
pip3 install ResBlaster
```

## Dependency

*   BLAST+ >2.7.0

*   cvmblaster (v0.4.1)

**you should add BLAST in your PATH**

## Blast installation

### Windows

Following this tutorial: [Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)

### Linux/Mac

The easyest way to install blast is:
```shell
conda install -c bioconda blast
```

## Usage

### 1. Initialize reference database

After finish installation, you should first initialize the reference database using following command
```shell
ResBlaster init
```

```shell
Usage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory>

Author: Qingpo Cui(SZQ Lab, China Agricultural University)

optional arguments:
  -h, --help            show this help message and exit
  -i I                  <input_path>: the PATH to the directory of assembled genome files
  -o O                  <output_directory>: output PATH
  -db DB                <database>: resfinder or others, You colud check database list using -list parameter
  -minid MINID          <minimum threshold of identity>, default=90
  -mincov MINCOV        <minimum threshold of coverage>, default=60
  -t T                  <number of threads>: default=8
  -store_arg_seq        <save the nucleotide and amino acid sequence of find genes on genome>
  -v, --version         <display version>
  -updatedb UPDATEDB    <add input fasta to BLAST database>
  -init                 <initialize the reference database>

ResBlaster subcommand:
  {show_db,init,updatedb}
    show_db             <show the list of all available database>
    init                <initialize the reference database>
    updatedb            <add custome database, use ResBlaster updatedb -h for help>


```
### 2. Making your own database

Let's say you want to make your own database called `owndb`. All you need is a FASTA file of nucleotide sequences, say `owndb.fsa`(**note: the fasta file must end with .fsa**). Ideally the sequence IDs would have the format `>GENE___ID___ACC___CATEGORY` where `GENE` is the name of `GENE`, `ID` is the `allele ID` of `GENE`, `ACC` is an accession number of the sequence source, `CATEGORY` is the `CATEGORY of this GENE belongs to`.

**Your final** `owndb.fsa` should like this:
```shell
>blaOXA-62___1___AY423074___Beta-lactam
ATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG
GTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA
GCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC
GTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC
GCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG
GCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG
CGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC
CTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG
AACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC
GACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC
ACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC
ACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC
GGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC
GACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG
GACCTGAAGCTGATCTGA
```
**Run following command will add** `owndb.fsa` to blast database

```shell
ResBlaster -updatedb owndb.fsa
```





            

Raw data

            {
    "_id": null,
    "home_page": "https://github.com/hbucqp/ResBlaster",
    "name": "ResBlaster",
    "maintainer": null,
    "docs_url": null,
    "requires_python": null,
    "maintainer_email": null,
    "keywords": "pip, wgs, blastn, amr",
    "author": "Qingpo Cui",
    "author_email": "cqp@cau.edu.cn",
    "download_url": "https://files.pythonhosted.org/packages/6c/aa/7ec9490e26f0a2919a4035bb67374df46fc5296020f23526d13e0fe43969/ResBlaster-0.4.3.tar.gz",
    "platform": "any",
    "description": "# ResBlaster\n\n![PYPI](https://img.shields.io/pypi/v/ResBlaster)\n![Static Badge](https://img.shields.io/badge/OS-_Windows_%7C_Mac_%7C_Linux-steelblue)\n\n```\n ____           ____  _           _\n|  _ \\ ___  ___| __ )| | __ _ ___| |_ ___ _ __\n| |_) / _ \\/ __|  _ \\| |/ _` / __| __/ _ \\ '__|\n|  _ <  __/\\__ \\ |_) | | (_| \\__ \\ ||  __/ |\n|_| \\_\\___||___/____/|_|\\__,_|___/\\__\\___|_|\n\n```\n\n## Installation\n```shell\npip3 install ResBlaster\n```\n\n## Dependency\n\n*   BLAST+ >2.7.0\n\n*   cvmblaster (v0.4.1)\n\n**you should add BLAST in your PATH**\n\n## Blast installation\n\n### Windows\n\nFollowing this tutorial: [Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)\n\n### Linux/Mac\n\nThe easyest way to install blast is:\n```shell\nconda install -c bioconda blast\n```\n\n## Usage\n\n### 1. Initialize reference database\n\nAfter finish installation, you should first initialize the reference database using following command\n```shell\nResBlaster init\n```\n\n```shell\nUsage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory>\n\nAuthor: Qingpo Cui(SZQ Lab, China Agricultural University)\n\noptional arguments:\n  -h, --help            show this help message and exit\n  -i I                  <input_path>: the PATH to the directory of assembled genome files\n  -o O                  <output_directory>: output PATH\n  -db DB                <database>: resfinder or others, You colud check database list using -list parameter\n  -minid MINID          <minimum threshold of identity>, default=90\n  -mincov MINCOV        <minimum threshold of coverage>, default=60\n  -t T                  <number of threads>: default=8\n  -store_arg_seq        <save the nucleotide and amino acid sequence of find genes on genome>\n  -v, --version         <display version>\n  -updatedb UPDATEDB    <add input fasta to BLAST database>\n  -init                 <initialize the reference database>\n\nResBlaster subcommand:\n  {show_db,init,updatedb}\n    show_db             <show the list of all available database>\n    init                <initialize the reference database>\n    updatedb            <add custome database, use ResBlaster updatedb -h for help>\n\n\n```\n### 2. Making your own database\n\nLet's say you want to make your own database called `owndb`. All you need is a FASTA file of nucleotide sequences, say `owndb.fsa`(**note: the fasta file must end with .fsa**). Ideally the sequence IDs would have the format `>GENE___ID___ACC___CATEGORY` where `GENE` is the name of `GENE`, `ID` is the `allele ID` of `GENE`, `ACC` is an accession number of the sequence source, `CATEGORY` is the `CATEGORY of this GENE belongs to`.\n\n**Your final** `owndb.fsa` should like this:\n```shell\n>blaOXA-62___1___AY423074___Beta-lactam\nATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG\nGTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA\nGCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC\nGTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC\nGCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG\nGCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG\nCGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC\nCTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG\nAACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC\nGACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC\nACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC\nACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC\nGGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC\nGACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG\nGACCTGAAGCTGATCTGA\n```\n**Run following command will add** `owndb.fsa` to blast database\n\n```shell\nResBlaster -updatedb owndb.fsa\n```\n\n\n\n\n",
    "bugtrack_url": null,
    "license": "MIT Licence",
    "summary": "find antimcirobial resistance genes on genomes",
    "version": "0.4.3",
    "project_urls": {
        "Homepage": "https://github.com/hbucqp/ResBlaster"
    },
    "split_keywords": [
        "pip",
        " wgs",
        " blastn",
        " amr"
    ],
    "urls": [
        {
            "comment_text": "",
            "digests": {
                "blake2b_256": "c4e5762b66ef24778faa380d667d5c56380acd03bf74dd216c3dd97385cef989",
                "md5": "351d9fb421364b32311cec3d529b9460",
                "sha256": "af00181b78200ad3aa4eb2c6d39242e17fad956379d4499de0fbfbc08ac9ea8a"
            },
            "downloads": -1,
            "filename": "ResBlaster-0.4.3-py3-none-any.whl",
            "has_sig": false,
            "md5_digest": "351d9fb421364b32311cec3d529b9460",
            "packagetype": "bdist_wheel",
            "python_version": "py3",
            "requires_python": null,
            "size": 20578374,
            "upload_time": "2024-10-09T11:09:24",
            "upload_time_iso_8601": "2024-10-09T11:09:24.559200Z",
            "url": "https://files.pythonhosted.org/packages/c4/e5/762b66ef24778faa380d667d5c56380acd03bf74dd216c3dd97385cef989/ResBlaster-0.4.3-py3-none-any.whl",
            "yanked": false,
            "yanked_reason": null
        },
        {
            "comment_text": "",
            "digests": {
                "blake2b_256": "6caa7ec9490e26f0a2919a4035bb67374df46fc5296020f23526d13e0fe43969",
                "md5": "7e2587a5a55f635f054de3c16238b0fb",
                "sha256": "6eeac598d5d3797ad1f2664c6cbfbf1c6d4b5ed76a7472e16c6e07b0d1ec907f"
            },
            "downloads": -1,
            "filename": "ResBlaster-0.4.3.tar.gz",
            "has_sig": false,
            "md5_digest": "7e2587a5a55f635f054de3c16238b0fb",
            "packagetype": "sdist",
            "python_version": "source",
            "requires_python": null,
            "size": 19057374,
            "upload_time": "2024-10-09T11:09:28",
            "upload_time_iso_8601": "2024-10-09T11:09:28.867845Z",
            "url": "https://files.pythonhosted.org/packages/6c/aa/7ec9490e26f0a2919a4035bb67374df46fc5296020f23526d13e0fe43969/ResBlaster-0.4.3.tar.gz",
            "yanked": false,
            "yanked_reason": null
        }
    ],
    "upload_time": "2024-10-09 11:09:28",
    "github": true,
    "gitlab": false,
    "bitbucket": false,
    "codeberg": false,
    "github_user": "hbucqp",
    "github_project": "ResBlaster",
    "travis_ci": false,
    "coveralls": false,
    "github_actions": false,
    "requirements": [
        {
            "name": "Bio",
            "specs": [
                [
                    "==",
                    "1.7.1"
                ]
            ]
        },
        {
            "name": "cvmblaster",
            "specs": [
                [
                    "==",
                    "0.4.3"
                ]
            ]
        },
        {
            "name": "cvmcore",
            "specs": [
                [
                    "==",
                    "0.1.7"
                ]
            ]
        },
        {
            "name": "pandas",
            "specs": [
                [
                    "==",
                    "1.4.0"
                ]
            ]
        },
        {
            "name": "setuptools",
            "specs": [
                [
                    "==",
                    "58.1.0"
                ]
            ]
        },
        {
            "name": "tabulate",
            "specs": [
                [
                    "==",
                    "0.9.0"
                ]
            ]
        }
    ],
    "lcname": "resblaster"
}
        
Elapsed time: 0.51676s