# ResBlaster
```
____ ____ _ _
| _ \ ___ ___| __ )| | __ _ ___| |_ ___ _ __
| |_) / _ \/ __| _ \| |/ _` / __| __/ _ \ '__|
| _ < __/\__ \ |_) | | (_| \__ \ || __/ |
|_| \_\___||___/____/|_|\__,_|___/\__\___|_|
```
## Installation
pip3 install ResBlaster
## Dependency
* BLAST+ >2.7.0
* cvmblaster (v0.4.1)
**you should add BLAST in your PATH**
## Blast installation
### Windows
Following this tutorial: [Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)
### Linux/Mac
The easyest way to install blast is:
conda install -c bioconda blast
## Usage
### 1. Initialize reference database
After finish installation, you should first initialize the reference database using following command
ResBlaster -init
<!---->
Usage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory> -minid 90 -mincov 60 -t 4
optional arguments:
-h, --help show this help message and exit
-i I <input_path>: the PATH to the directory of assembled genome files
-o O <output_directory>: output PATH
-db DB <database>: resfinder or others, You colud check database list using -list parameter
-minid MINID <minimum threshold of identity>, default=90
-mincov MINCOV <minimum threshold of coverage>, default=60
-list <show database list>
-init <initialize the reference database>
-t T <number of threads>: default=8
-store_arg_seq save the nucleotide and amino acid sequence of find genes on genome
-v, --version Display version
### 2. Making your own database
Let's say you want to make your own database called `owndb`. All you need is a FASTA file of nucleotide sequences, say `owndb.fsa`(**note: the fasta file must end with .fsa**). Ideally the sequence IDs would have the format `>GENE___ID___ACC___CATEGORY` where `GENE` is the name of `GENE`, `ID` is the `allele ID` of `GENE`, `ACC` is an accession number of the sequence source, `CATEGORY` is the `CATEGORY of this GENE belongs to`.
**Your final **`owndb.fsa` should like this:
>blaOXA-62___1___AY423074___Beta-lactam
ATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG
GTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA
GCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC
GTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC
GCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG
GCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG
CGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC
CTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG
AACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC
GACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC
ACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC
ACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC
GGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC
GACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG
GACCTGAAGCTGATCTGA
**Run following command will add **`owndb.fsa` to blast database
% ResBlaster -updatedb owndb.fsa
### 3. Features under development
**Following database are currently under development and will be available soon:**
| Database | Description |
| ----------- | -------------------------------------------------------------------- |
| vfdb\_core | The core dataset of vfdb |
| vfdb\_full | The full database of vfdb |
| ncbi | Bacterial Antimicrobial Resistance Reference Gene Database from NCBI |
| resfinder | ARGs from ResFinder |
| ssuis\_sero | The serotype database for Streptococcus suis |
| hps | The serotype database for Haemophilus parasuis |
| lmo | Listeria monocytogenes relevant genes from Pasteur Institute |
| ESBL | ESBL genes |
Raw data
{
"_id": null,
"home_page": "https://github.com/hbucqp/ResBlaster",
"name": "ResBlaster",
"maintainer": null,
"docs_url": null,
"requires_python": null,
"maintainer_email": null,
"keywords": "pip, wgs, blastn, amr",
"author": "Qingpo Cui",
"author_email": "cqp@cau.edu.cn",
"download_url": "https://files.pythonhosted.org/packages/e3/0c/27af11f899ec23b1a143d53bfc596d21a79e0581dea1c674e6e2b92a5610/ResBlaster-0.4.0.tar.gz",
"platform": "any",
"description": "# ResBlaster\n\n\n\n```\n ____ ____ _ _\n| _ \\ ___ ___| __ )| | __ _ ___| |_ ___ _ __\n| |_) / _ \\/ __| _ \\| |/ _` / __| __/ _ \\ '__|\n| _ < __/\\__ \\ |_) | | (_| \\__ \\ || __/ |\n|_| \\_\\___||___/____/|_|\\__,_|___/\\__\\___|_|\n\n```\n\n## Installation\n\npip3 install ResBlaster\n\n## Dependency\n\n* BLAST+ >2.7.0\n\n* cvmblaster (v0.4.1)\n\n**you should add BLAST in your PATH**\n\n## Blast installation\n\n### Windows\n\nFollowing this tutorial: [Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)\n\n### Linux/Mac\n\nThe easyest way to install blast is:\n\n conda install -c bioconda blast\n\n## Usage\n\n### 1. Initialize reference database\n\nAfter finish installation, you should first initialize the reference database using following command\n\n ResBlaster -init\n\n<!---->\n\n Usage: ResBlaster -i <genome assemble directory> -db <reference database> -o <output_directory> -minid 90 -mincov 60 -t 4\n\n\n optional arguments:\n -h, --help show this help message and exit\n -i I <input_path>: the PATH to the directory of assembled genome files\n -o O <output_directory>: output PATH\n -db DB <database>: resfinder or others, You colud check database list using -list parameter\n -minid MINID <minimum threshold of identity>, default=90\n -mincov MINCOV <minimum threshold of coverage>, default=60\n -list <show database list>\n -init <initialize the reference database>\n -t T <number of threads>: default=8\n -store_arg_seq save the nucleotide and amino acid sequence of find genes on genome\n -v, --version Display version\n\n### 2. Making your own database\n\nLet's say you want to make your own database called `owndb`. All you need is a FASTA file of nucleotide sequences, say `owndb.fsa`(**note: the fasta file must end with .fsa**). Ideally the sequence IDs would have the format `>GENE___ID___ACC___CATEGORY` where `GENE` is the name of `GENE`, `ID` is the `allele ID` of `GENE`, `ACC` is an accession number of the sequence source, `CATEGORY` is the `CATEGORY of this GENE belongs to`.\n\n**Your final **`owndb.fsa` should like this:\n\n >blaOXA-62___1___AY423074___Beta-lactam\n ATGAATACGATAATCTCTCGCCGGTGGCGTGCCGGCCTGTGGCGGCGGCTGGTCGGCGCG\n GTCGTCTTGCCCGCAACGCTCGCCGCCACCCCTGCGGCCTATGCGGCCGACGTGCCGAAA\n GCCGCGTTGGGGCGCATCACCGAGCGCGCCGACTGGGGCAAGCTGTTCGCCGCGGAGGGC\n GTGAAGGGCACGATCGTGGTGCTCGACGCACGCACGCAAACCTATCAGGCCTACGACGCC\n GCACGTGCCGAGAAGCGCATGTCGCCGGCGTCGACCTACAAGATATTCAACAGCCTGCTG\n GCGCTCGACTCCGGGGCGCTGGACAACGAACGCGCGATCATTCCCTGGGATGGCAAGCCG\n CGACGCATCAAGAACTGGAACGCGGCGATGGACCTGAGGACCGCGTTTCGCGTGTCATGC\n CTGCCCTGCTATCAGGTCGTCTCGCACAAGATCGGGCGCCGGTACGCGCAGGCGAAGCTG\n AACGAGGTCGGGTATGGCAACCGCACCATTGGCGGCGCGCCGGACGCCTATTGGGTCGAC\n GACAGTCTGCAGATTTCGGCGCGTGAGCAGGTGGACTTCGTGCAGCGTCTCGCGCGTGGC\n ACGTTGCCGTTCTCTGCGCGCTCGCAGGACATCGTGCGCCAGATGTCGATCGTCGAAGCC\n ACGCCGGACTATGTGCTTCACGGCAAGACGGGTTGGTTCGTCGACAAGAAGCCCGATATC\n GGCTGGTGGGTAGGGTGGATCGAGCGCGACGGCAACATCACCAGCGTCGCGATCAACATC\n GACATGCTGTCGGAGGCGGACGCCCCGAAACGGGCACGCATCGTGAAGGCGGTGCTGAAG\n GACCTGAAGCTGATCTGA\n\n**Run following command will add **`owndb.fsa` to blast database\n\n % ResBlaster -updatedb owndb.fsa\n\n### 3. Features under development\n\n**Following database are currently under development and will be available soon:**\n\n| Database | Description |\n| ----------- | -------------------------------------------------------------------- |\n| vfdb\\_core | The core dataset of vfdb |\n| vfdb\\_full | The full database of vfdb |\n| ncbi | Bacterial Antimicrobial Resistance Reference Gene Database from NCBI |\n| resfinder | ARGs from ResFinder |\n| ssuis\\_sero | The serotype database for Streptococcus suis |\n| hps | The serotype database for Haemophilus parasuis |\n| lmo | Listeria monocytogenes relevant genes from Pasteur Institute |\n| ESBL | ESBL genes |\n\n\n\n",
"bugtrack_url": null,
"license": "MIT Licence",
"summary": "find antimcirobial resistance genes on genomes",
"version": "0.4.0",
"project_urls": {
"Homepage": "https://github.com/hbucqp/ResBlaster"
},
"split_keywords": [
"pip",
" wgs",
" blastn",
" amr"
],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "44b6bbff2a80d95e737d39ad5e87021ff6d4244b3bfd59e42e744dcb32813413",
"md5": "a5acfbc5aa887a7e9ce18c94e314f6a6",
"sha256": "c9adc7deb968332a039683e7b5d722e382a460267b180441d4302438e5bfd1bb"
},
"downloads": -1,
"filename": "ResBlaster-0.4.0-py3-none-any.whl",
"has_sig": false,
"md5_digest": "a5acfbc5aa887a7e9ce18c94e314f6a6",
"packagetype": "bdist_wheel",
"python_version": "py3",
"requires_python": null,
"size": 13998814,
"upload_time": "2024-04-25T03:04:15",
"upload_time_iso_8601": "2024-04-25T03:04:15.057125Z",
"url": "https://files.pythonhosted.org/packages/44/b6/bbff2a80d95e737d39ad5e87021ff6d4244b3bfd59e42e744dcb32813413/ResBlaster-0.4.0-py3-none-any.whl",
"yanked": false,
"yanked_reason": null
},
{
"comment_text": "",
"digests": {
"blake2b_256": "e30c27af11f899ec23b1a143d53bfc596d21a79e0581dea1c674e6e2b92a5610",
"md5": "f7863b76065b72c3afd32d3411cccbd5",
"sha256": "760109efd2bed7394d21093312ffe80c17e108433624f584efcadf4f76a8773a"
},
"downloads": -1,
"filename": "ResBlaster-0.4.0.tar.gz",
"has_sig": false,
"md5_digest": "f7863b76065b72c3afd32d3411cccbd5",
"packagetype": "sdist",
"python_version": "source",
"requires_python": null,
"size": 12736236,
"upload_time": "2024-04-25T03:04:26",
"upload_time_iso_8601": "2024-04-25T03:04:26.563767Z",
"url": "https://files.pythonhosted.org/packages/e3/0c/27af11f899ec23b1a143d53bfc596d21a79e0581dea1c674e6e2b92a5610/ResBlaster-0.4.0.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2024-04-25 03:04:26",
"github": true,
"gitlab": false,
"bitbucket": false,
"codeberg": false,
"github_user": "hbucqp",
"github_project": "ResBlaster",
"travis_ci": false,
"coveralls": false,
"github_actions": false,
"requirements": [],
"lcname": "resblaster"
}
JSON
