# BenchlingAPI
[](https://badge.fury.io/py/benchlingapi)
The (unofficial) python API wrapper for Benchling. For more information,
see documentation at https://klavinslab.github.io/benchling-api/index.
## Installation
```
pip install benchlingapi -U
```
## Getting Started
Initialize a session using your Benchling-provided API key:
```python
from benchlingapi import Session
session = Session("your_secret_benchling_api_key")
```
From there, you can access various models:
```python
session.DNASequence
session.AASequence
session.Oligo
session.Folder
session.Project
session.Registry
session.Translation
session.EntitySchema
session.Batch
session.CustomEntity
```
Finding models:
```python
# get one model
dna = session.DNASequence.one()
# find a specific model by its id
dna = session.DNASequence.find('sdg_4tg23')
# get the last 50 amino acids
proteins = session.AASequence.last(50)
# get a registry by name
registry = session.Registry.find_by_name("Klavins Lab Registry")
```
Updating models:
```python
dna = session.DNASequence.one()
dna.name = "My new name"
dna.bases = "AGGTAGGGTAGGGCCAGAGA"
# update the sequence on the server
dna.update()
```
Saving new models:
```python
folder = session.Folder.find_by_name("My API Folder")
dna = session.DNASequence(
name = 'my new dna',
bases = 'AGGTAGGATGGCCA',
folder_id = folder.id,
is_circular = False
)
# save the dna to your Benchling account
dna.save()
```
Registering models to your registry:
```python
dna.set_schema("My DNA Schema")
dna.register()
```
See the documentation for more information: https://klavinslab.github.io/benchling-api/index
## Testing
Testing is done using `pytest`. Tests will create live requests to a Benchling account.
Since testing is done live, a Benchling account will need to be setup along with testing
data.
To run tests, you must have a Benchling Account with an API key. Tests require a file in
'tests/secrets/config.json' with the following format:
```
{
"credentials": {
"api_key": "asdahhjwrthsdfgadfadfgadadsfa"
},
"sharelinks": [
"https://benchling.com/s/seq-asdfadsfaee"
],
"project": {
"name": "API"
},
"trash_folder": {
"name": "API_Trash"
},
"inventory_folder": {
"name": "API_Inventory"
}
}
```
On the Benchling side of things, in the account liked to the `credentials["api_key"]`, you must
have a project corresponding to the `project["name"]` value above. Within this project, you should
have two folder corresponding to the `trash_folder` and `inventory_folder` values above. Additionally,
you should have at least one example of an AminoAcid, DNASequence, CustomEntity, and Oligo stored within
your `inventory_folder`. Tests will copy the examples from the `inventory_folder` for downstream tests.
After the tests, conclude, inventory in the `trash_folder` will get archived.
#### Happy Cloning!
Raw data
{
"_id": null,
"home_page": "https://www.github.com/klavinslab/benchling-api",
"name": "benchlingapi",
"maintainer": "Justin Vrana",
"docs_url": null,
"requires_python": ">=3.5.2,<4.0.0",
"maintainer_email": "justin.vrana@gmail.com",
"keywords": "",
"author": "Justin Vrana",
"author_email": "justin.vrana@gmail.com",
"download_url": "https://files.pythonhosted.org/packages/8d/3e/d438187289d120508725d5769762468d7980030a79b86ad61d278d54b937/benchlingapi-2.1.12.tar.gz",
"platform": "",
"description": "# BenchlingAPI\n\n[](https://badge.fury.io/py/benchlingapi)\n\nThe (unofficial) python API wrapper for Benchling. For more information,\nsee documentation at https://klavinslab.github.io/benchling-api/index.\n\n## Installation\n\n```\npip install benchlingapi -U\n```\n\n## Getting Started\n\nInitialize a session using your Benchling-provided API key:\n\n```python\nfrom benchlingapi import Session\nsession = Session(\"your_secret_benchling_api_key\")\n```\n\nFrom there, you can access various models:\n\n```python\nsession.DNASequence\nsession.AASequence\nsession.Oligo\nsession.Folder\nsession.Project\nsession.Registry\nsession.Translation\nsession.EntitySchema\nsession.Batch\nsession.CustomEntity\n```\n\nFinding models:\n\n```python\n# get one model\ndna = session.DNASequence.one()\n\n# find a specific model by its id\ndna = session.DNASequence.find('sdg_4tg23')\n\n# get the last 50 amino acids\nproteins = session.AASequence.last(50)\n\n# get a registry by name\nregistry = session.Registry.find_by_name(\"Klavins Lab Registry\")\n```\n\nUpdating models:\n\n```python\ndna = session.DNASequence.one()\ndna.name = \"My new name\"\ndna.bases = \"AGGTAGGGTAGGGCCAGAGA\"\n\n# update the sequence on the server\ndna.update()\n```\n\nSaving new models:\n\n```python\nfolder = session.Folder.find_by_name(\"My API Folder\")\ndna = session.DNASequence(\n name = 'my new dna',\n bases = 'AGGTAGGATGGCCA',\n folder_id = folder.id,\n is_circular = False\n)\n\n# save the dna to your Benchling account\ndna.save()\n```\n\nRegistering models to your registry:\n\n```python\ndna.set_schema(\"My DNA Schema\")\ndna.register()\n```\n\nSee the documentation for more information: https://klavinslab.github.io/benchling-api/index\n\n## Testing\n\nTesting is done using `pytest`. Tests will create live requests to a Benchling account.\nSince testing is done live, a Benchling account will need to be setup along with testing\ndata.\n\nTo run tests, you must have a Benchling Account with an API key. Tests require a file in\n'tests/secrets/config.json' with the following format:\n\n```\n{\n \"credentials\": {\n \"api_key\": \"asdahhjwrthsdfgadfadfgadadsfa\"\n },\n \"sharelinks\": [\n \"https://benchling.com/s/seq-asdfadsfaee\"\n ],\n \"project\": {\n \"name\": \"API\"\n },\n \"trash_folder\": {\n \"name\": \"API_Trash\"\n },\n \"inventory_folder\": {\n \"name\": \"API_Inventory\"\n }\n}\n```\n\nOn the Benchling side of things, in the account liked to the `credentials[\"api_key\"]`, you must\nhave a project corresponding to the `project[\"name\"]` value above. Within this project, you should\nhave two folder corresponding to the `trash_folder` and `inventory_folder` values above. Additionally,\nyou should have at least one example of an AminoAcid, DNASequence, CustomEntity, and Oligo stored within\nyour `inventory_folder`. Tests will copy the examples from the `inventory_folder` for downstream tests.\nAfter the tests, conclude, inventory in the `trash_folder` will get archived.\n\n#### Happy Cloning!\n",
"bugtrack_url": null,
"license": "",
"summary": "An unofficial python wrapper for the Benchling API",
"version": "2.1.12",
"project_urls": {
"Documentation": "http://klavinslab.org/benchling-api/",
"Homepage": "https://www.github.com/klavinslab/benchling-api",
"Repository": "https://pypi.org/project/benchlingapi/"
},
"split_keywords": [],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "f2007d2f5d70cc508e31ae7d4244b85274384aa67628984c20073518dd5e2be0",
"md5": "059954b1936b2cfb145e5c7262df99a6",
"sha256": "10e5786a2b23fe6557475aac6f42e6f3218654f09e8ca6824820d2cba46019fb"
},
"downloads": -1,
"filename": "benchlingapi-2.1.12-py3-none-any.whl",
"has_sig": false,
"md5_digest": "059954b1936b2cfb145e5c7262df99a6",
"packagetype": "bdist_wheel",
"python_version": "py3",
"requires_python": ">=3.5.2,<4.0.0",
"size": 23017,
"upload_time": "2020-02-13T00:27:30",
"upload_time_iso_8601": "2020-02-13T00:27:30.827580Z",
"url": "https://files.pythonhosted.org/packages/f2/00/7d2f5d70cc508e31ae7d4244b85274384aa67628984c20073518dd5e2be0/benchlingapi-2.1.12-py3-none-any.whl",
"yanked": false,
"yanked_reason": null
},
{
"comment_text": "",
"digests": {
"blake2b_256": "8d3ed438187289d120508725d5769762468d7980030a79b86ad61d278d54b937",
"md5": "655c2bc95e348fea0c5d0ddec94f4e08",
"sha256": "8ee7f03919a4ac27441601d35d52fa877db95a00f8b5c788ac37aff187d692a2"
},
"downloads": -1,
"filename": "benchlingapi-2.1.12.tar.gz",
"has_sig": false,
"md5_digest": "655c2bc95e348fea0c5d0ddec94f4e08",
"packagetype": "sdist",
"python_version": "source",
"requires_python": ">=3.5.2,<4.0.0",
"size": 21544,
"upload_time": "2020-02-13T00:27:32",
"upload_time_iso_8601": "2020-02-13T00:27:32.405446Z",
"url": "https://files.pythonhosted.org/packages/8d/3e/d438187289d120508725d5769762468d7980030a79b86ad61d278d54b937/benchlingapi-2.1.12.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2020-02-13 00:27:32",
"github": true,
"gitlab": false,
"bitbucket": false,
"codeberg": false,
"github_user": "klavinslab",
"github_project": "benchling-api",
"travis_ci": false,
"coveralls": false,
"github_actions": true,
"tox": true,
"lcname": "benchlingapi"
}