pyfaidx


Namepyfaidx JSON
Version 0.9.0.2 PyPI version JSON
download
home_pageNone
Summarypyfaidx: efficient pythonic random access to fasta subsequences
upload_time2025-09-03 01:45:14
maintainerNone
docs_urlhttps://pythonhosted.org/pyfaidx/
authorNone
requires_python>=3.7
licenseBSD-3-Clause
keywords
VCS
bugtrack_url
requirements No requirements were recorded.
Travis-CI No Travis.
coveralls test coverage
            |CI| |Package| |PyPI| |Coverage| |Downloads|

Description
-----------

Samtools provides a function "faidx" (FAsta InDeX), which creates a
small flat index file ".fai" allowing for fast random access to any
subsequence in the indexed FASTA file, while loading a minimal amount of the
file in to memory. This python module implements pure Python classes for
indexing, retrieval, and in-place modification of FASTA files using a samtools
compatible index. The pyfaidx module is API compatible with the `pygr`_ seqdb module.
A command-line script "`faidx`_" is installed alongside the pyfaidx module, and
facilitates complex manipulation of FASTA files without any programming knowledge.

.. _`pygr`: https://github.com/cjlee112/pygr

If you use pyfaidx in your publication, please cite:

`Shirley MD`_, `Ma Z`_, `Pedersen B`_, `Wheelan S`_. `Efficient "pythonic" access to FASTA files using pyfaidx <https://dx.doi.org/10.7287/peerj.preprints.970v1>`_. PeerJ PrePrints 3:e1196. 2015.

.. _`Shirley MD`: http://github.com/mdshw5
.. _`Ma Z`: http://github.com/azalea
.. _`Pedersen B`: http://github.com/brentp
.. _`Wheelan S`: http://github.com/swheelan

Installation
------------

This package is tested under Linux and macOS using Python 3.7+, and and is available from the PyPI:

::

    pip install pyfaidx  # add --user if you don't have root

or download a `release <https://github.com/mdshw5/pyfaidx/releases>`_ and:

::

    pip install .

If using ``pip install --user`` make sure to add ``/home/$USER/.local/bin`` to your ``$PATH`` (on linux) or ``/Users/$USER/Library/Python/{python version}/bin`` (on macOS) if you want to run the ``faidx`` script.

Python 2.6 and 2.7 users may choose to use a package version from `v0.7.2 <https://github.com/mdshw5/pyfaidx/releases/tag/v0.7.2.2>`_ or earier.

Usage
-----

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> genes
    Fasta("tests/data/genes.fasta")  # set strict_bounds=True for bounds checking

Acts like a dictionary.

.. code:: python

    >>> genes.keys()
    ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')

    >>> genes['NM_001282543.1'][200:230]
    >NM_001282543.1:201-230
    CTCGTTCCGCGCCCGCCATGGAACCGGATG

    >>> genes['NM_001282543.1'][200:230].seq
    'CTCGTTCCGCGCCCGCCATGGAACCGGATG'

    >>> genes['NM_001282543.1'][200:230].name
    'NM_001282543.1'

    # Start attributes are 1-based
    >>> genes['NM_001282543.1'][200:230].start
    201

    # End attributes are 0-based
    >>> genes['NM_001282543.1'][200:230].end
    230

    >>> genes['NM_001282543.1'][200:230].fancy_name
    'NM_001282543.1:201-230'

    >>> len(genes['NM_001282543.1'])
    5466

Note that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``. This argument only affects the ``Sequence .start/.end`` attributes, and has no effect on slicing coordinates.

Indexes like a list:

.. code:: python

    >>> genes[0][:50]
    >AB821309.1:1-50
    ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC

Slices just like a string:

.. code:: python

    >>> genes['NM_001282543.1'][200:230][:10]
    >NM_001282543.1:201-210
    CTCGTTCCGC

    >>> genes['NM_001282543.1'][200:230][::-1]
    >NM_001282543.1:230-201
    GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

    >>> genes['NM_001282543.1'][200:230][::3]
    >NM_001282543.1:201-230
    CGCCCCTACA

    >>> genes['NM_001282543.1'][:]
    >NM_001282543.1:1-5466
    CCCCGCCCCT........

- Slicing start and end coordinates are 0-based, just like Python sequences.

Complements and reverse complements just like DNA

.. code:: python

    >>> genes['NM_001282543.1'][200:230].complement
    >NM_001282543.1 (complement):201-230
    GAGCAAGGCGCGGGCGGTACCTTGGCCTAC

    >>> genes['NM_001282543.1'][200:230].reverse
    >NM_001282543.1:230-201
    GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

    >>> -genes['NM_001282543.1'][200:230]
    >NM_001282543.1 (complement):230-201
    CATCCGGTTCCATGGCGGGCGCGGAACGAG

``Fasta`` objects can also be accessed using method calls:

.. code:: python

    >>> genes.get_seq('NM_001282543.1', 201, 210)
    >NM_001282543.1:201-210
    CTCGTTCCGC

    >>> genes.get_seq('NM_001282543.1', 201, 210, rc=True)
    >NM_001282543.1 (complement):210-201
    GCGGAACGAG

Spliced sequences can be retrieved from a list of [start, end] coordinates:
**TODO** update this section

.. code:: python

    # new in v0.5.1
    segments = [[1, 10], [50, 70]]
    >>> genes.get_spliced_seq('NM_001282543.1', segments)
    >gi|543583786|ref|NM_001282543.1|:1-70
    CCCCGCCCCTGGTTTCGAGTCGCTGGCCTGC

.. _keyfn:

Custom key functions provide cleaner access:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
    >>> genes.keys()
    dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
    >>> genes['NR_104212'][:10]
    >NR_104212:1-10
    CCCCGCCCCT

You can specify a character to split names on, which will generate additional entries:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', split_char='.', duplicate_action="first") # default duplicate_action="stop"
    >>> genes.keys()
    dict_keys(['.1', 'NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])

If your `key_function` or `split_char` generates duplicate entries, you can choose what action to take:

.. code:: python

    # new in v0.4.9
    >>> genes = Fasta('tests/data/genes.fasta', split_char="|", duplicate_action="longest")
    >>> genes.keys()
    dict_keys(['gi', '563317589', 'dbj', 'AB821309.1', '', '557361099', 'gb', 'KF435150.1', '557361097', 'KF435149.1', '543583796', 'ref', 'NR_104216.1', '543583795', 'NR_104215.1', '543583794', 'NR_104212.1', '543583788', 'NM_001282545.1', '543583786', 'NM_001282543.1', '543583785', 'NM_000465.3', '543583740', 'NM_001282549.1', '543583738', 'NM_001282548.1', '530384540', 'XM_005249645.1', '530384538', 'XM_005249644.1', '530384536', 'XM_005249643.1', '530384534', 'XM_005249642.1', '530373237','XM_005265508.1', '530373235', 'XM_005265507.1', '530364726', 'XR_241081.1', '530364725', 'XR_241080.1', '530364724', 'XR_241079.1'])

Filter functions (returning True) limit the index:

.. code:: python

    # new in v0.3.8
    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', filt_function = lambda x: x[0] == 'N')
    >>> genes.keys()
    dict_keys(['NR_104212', 'NM_001282543', 'NR_104216', 'NR_104215', 'NM_001282549', 'NM_000465', 'NM_001282545', 'NM_001282548'])
    >>> genes['XM_005249644']
    KeyError: XM_005249644 not in tests/data/genes.fasta.

Or just get a Python string:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
    >>> genes
    Fasta("tests/data/genes.fasta", as_raw=True)

    >>> genes['NM_001282543.1'][200:230]
    CTCGTTCCGCGCCCGCCATGGAACCGGATG

You can make sure that you always receive an uppercase sequence, even if your fasta file has lower case

.. code:: python

    >>> from pyfaidx import Fasta
    >>> reference = Fasta('tests/data/genes.fasta.lower', sequence_always_upper=True)
    >>> reference['gi|557361099|gb|KF435150.1|'][1:70]

    >gi|557361099|gb|KF435150.1|:2-70
    TGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA


You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> for line in genes['NM_001282543.1']:
    ...   print(line)
    CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
    AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
    CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
    ...

Sequence names are truncated on any whitespace. This is a limitation of the indexing strategy. However, full names can be recovered:

.. code:: python

    # new in v0.3.7
    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> for record in genes:
    ...   print(record.name)
    ...   print(record.long_name)
    ...
    gi|563317589|dbj|AB821309.1|
    gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
    gi|557361099|gb|KF435150.1|
    gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
    gi|557361097|gb|KF435149.1|
    gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds
    ...

    # new in v0.4.9
    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', read_long_names=True)
    >>> for record in genes:
    ...   print(record.name)
    ...
    gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
    gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
    gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds

Records can be accessed efficiently as numpy arrays:

.. code:: python

    # new in v0.5.4
    >>> from pyfaidx import Fasta
    >>> import numpy as np
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> np.asarray(genes['NM_001282543.1'])
    array(['C', 'C', 'C', ..., 'A', 'A', 'A'], dtype='|S1')

Sequence can be buffered in memory using a read-ahead buffer
for fast sequential access:

.. code:: python

    >>> from timeit import timeit
    >>> fetch = "genes['NM_001282543.1'][200:230]"
    >>> read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta', read_ahead=10000)"
    >>> no_read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta')"
    >>> string_slicing = "genes = {}; genes['NM_001282543.1'] = 'N'*10000"

    >>> timeit(fetch, no_read_ahead, number=10000)
    0.2204863309962093
    >>> timeit(fetch, read_ahead, number=10000)
    0.1121859749982832
    >>> timeit(fetch, string_slicing, number=10000)
    0.0033553699977346696

Read-ahead buffering can reduce runtime by 1/2 for sequential accesses to buffered regions.

.. role:: red

If you want to modify the contents of your FASTA file in-place, you can use the `mutable` argument.
Any portion of the FastaRecord can be replaced with an equivalent-length string.
:red:`Warning`: *This will change the contents of your file immediately and permanently:*

.. code:: python

    >>> genes = Fasta('tests/data/genes.fasta', mutable=True)
    >>> type(genes['NM_001282543.1'])
    <class 'pyfaidx.MutableFastaRecord'>

    >>> genes['NM_001282543.1'][:10]
    >NM_001282543.1:1-10
    CCCCGCCCCT
    >>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
    >>> genes['NM_001282543.1'][:15]
    >NM_001282543.1:1-15
    NNNNNNNNNNCTGGC

The FastaVariant class provides a way to integrate single nucleotide variant calls to generate a consensus sequence.

.. code:: python

    # new in v0.4.0
    >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', het=True, hom=True)
    RuntimeWarning: Using sample NA06984 genotypes.

    >>> consensus['22'].variant_sites
    (16042793, 21833121, 29153196, 29187373, 29187448, 29194610, 29821295, 29821332, 29993842, 32330460, 32352284)

    >>> consensus['22'][16042790:16042800]
    >22:16042791-16042800
    TCGTAGGACA

    >>> Fasta('tests/data/chr22.fasta')['22'][16042790:16042800]
    >22:16042791-16042800
    TCATAGGACA

    >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', sample='NA06984', het=True, hom=True, call_filter='GT == "0/1"')
    >>> consensus['22'].variant_sites
    (16042793, 29187373, 29187448, 29194610, 29821332)
    
You can also specify paths using ``pathlib.Path`` objects.

.. code:: python
    
    #new in v0.7.1
    >>> from pyfaidx import Fasta
    >>> from pathlib import Path
    >>> genes = Fasta(Path('tests/data/genes.fasta'))
    >>> genes
    Fasta("tests/data/genes.fasta")

Accessing fasta files from `filesystem_spec <https://filesystem-spec.readthedocs.io>`_ filesystems:

.. code:: python

    # new in v0.7.0
    # pip install fsspec s3fs
    >>> import fsspec
    >>> from pyfaidx import Fasta
    >>> of = fsspec.open("s3://broad-references/hg19/v0/Homo_sapiens_assembly19.fasta", anon=True)
    >>> genes = Fasta(of)


.. _faidx:

It also provides a command-line script:

cli script: faidx
~~~~~~~~~~~~~~~~~

.. code:: bash

    Fetch sequences from FASTA. If no regions are specified, all entries in the
    input file are returned. Input FASTA file must be consistently line-wrapped,
    and line wrapping of output is based on input line lengths.

    positional arguments:
      fasta                 FASTA file
      regions               space separated regions of sequence to fetch e.g.
                            chr1:1-1000

    optional arguments:
      -h, --help            show this help message and exit
      -b BED, --bed BED     bed file of regions (zero-based start coordinate)
      -o OUT, --out OUT     output file name (default: stdout)
      -i {bed,chromsizes,nucleotide,transposed}, --transform {bed,chromsizes,nucleotide,transposed} transform the requested regions into another format. default: None
      -c, --complement      complement the sequence. default: False
      -r, --reverse         reverse the sequence. default: False
      -a SIZE_RANGE, --size-range SIZE_RANGE
                            selected sequences are in the size range [low, high]. example: 1,1000 default: None
      -n, --no-names        omit sequence names from output. default: False
      -f, --full-names      output full names including description. default: False
      -x, --split-files     write each region to a separate file (names are derived from regions)
      -l, --lazy            fill in --default-seq for missing ranges. default: False
      -s DEFAULT_SEQ, --default-seq DEFAULT_SEQ
                            default base for missing positions and masking. default: None
      -d DELIMITER, --delimiter DELIMITER
                            delimiter for splitting names to multiple values (duplicate names will be discarded). default: None
      -e HEADER_FUNCTION, --header-function HEADER_FUNCTION
                            python function to modify header lines e.g: "lambda x: x.split("|")[0]". default: lambda x: x.split()[0]
      -u {stop,first,last,longest,shortest}, --duplicates-action {stop,first,last,longest,shortest}
                            entry to take when duplicate sequence names are encountered. default: stop
      -g REGEX, --regex REGEX
                            selected sequences are those matching regular expression. default: .*
      -v, --invert-match    selected sequences are those not matching 'regions' argument. default: False
      -m, --mask-with-default-seq
                            mask the FASTA file using --default-seq default: False
      -M, --mask-by-case    mask the FASTA file by changing to lowercase. default: False
      -e HEADER_FUNCTION, --header-function HEADER_FUNCTION
                            python function to modify header lines e.g: "lambda x: x.split("|")[0]". default: None
      --no-rebuild          do not rebuild the .fai index even if it is out of date. default: False
      --version             print pyfaidx version number

Examples:

.. code:: bash

    $ faidx -v tests/data/genes.fasta
    ### Creates an .fai index, but supresses sequence output using --invert-match ###

    $ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
    >NM_001282543.1:201-210
    CTCGTTCCGC
    >NM_001282543.1:300-320
    GTAATTGTGTAAGTGACTGCA

    $ faidx --full-names tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1| Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant 2, mRNA
    CTCGTTCCGC

    $ faidx --no-names tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
    CTCGTTCCGC
    GTAATTGTGTAAGTGACTGCA

    $ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1:201-210 (complement)
    GAGCAAGGCG

    $ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1:210-201
    CGCCTTGCTC

    $ faidx --reverse --complement tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1:210-201 (complement)
    GCGGAACGAG

    $ faidx tests/data/genes.fasta NM_001282543.1
    >NM_001282543.1:1-5466
    CCCCGCCCCT........
    ..................
    ..................
    ..................

    $ faidx --regex "^NM_00128254[35]" genes.fasta
    >NM_001282543.1
    ..................
    ..................
    ..................
    >NM_001282545.1
    ..................
    ..................
    ..................

    $ faidx --lazy tests/data/genes.fasta NM_001282543.1:5460-5480
    >NM_001282543.1:5460-5480
    AAAAAAANNNNNNNNNNNNNN

    $ faidx --lazy --default-seq='Q' tests/data/genes.fasta NM_001282543.1:5460-5480
    >NM_001282543.1:5460-5480
    AAAAAAAQQQQQQQQQQQQQQ

    $ faidx tests/data/genes.fasta --bed regions.bed
    ...

    $ faidx --transform chromsizes tests/data/genes.fasta
    AB821309.1	3510
    KF435150.1	481
    KF435149.1	642
    NR_104216.1	4573
    NR_104215.1	5317
    NR_104212.1	5374
    ...

    $ faidx --transform bed tests/data/genes.fasta
    AB821309.1	1    3510
    KF435150.1	1    481
    KF435149.1	1    642
    NR_104216.1	1   4573
    NR_104215.1	1   5317
    NR_104212.1	1   5374
    ...

    $ faidx --transform nucleotide tests/data/genes.fasta
    name	start	end	A	T	C	G	N
    AB821309.1	1	3510	955	774	837	944	0
    KF435150.1	1	481	149	120	103	109	0
    KF435149.1	1	642	201	163	129	149	0
    NR_104216.1	1	4573	1294	1552	828	899	0
    NR_104215.1	1	5317	1567	1738	968	1044	0
    NR_104212.1	1	5374	1581	1756	977	1060	0
    ...

    faidx --transform transposed tests/data/genes.fasta
    AB821309.1	1	3510	ATGGTCAGCTGGGGTCGTTTCATC...
    KF435150.1	1	481	ATGACATCATTTTCCACCTCTGCT...
    KF435149.1	1	642	ATGACATCATTTTCCACCTCTGCT...
    NR_104216.1	1	4573	CCCCGCCCCTCTGGCGGCCCGCCG...
    NR_104215.1	1	5317	CCCCGCCCCTCTGGCGGCCCGCCG...
    NR_104212.1	1	5374	CCCCGCCCCTCTGGCGGCCCGCCG...
    ...

    $ faidx --split-files tests/data/genes.fasta
    $ ls
    AB821309.1.fasta	NM_001282549.1.fasta	XM_005249645.1.fasta
    KF435149.1.fasta	NR_104212.1.fasta	XM_005265507.1.fasta
    KF435150.1.fasta	NR_104215.1.fasta	XM_005265508.1.fasta
    NM_000465.3.fasta	NR_104216.1.fasta	XR_241079.1.fasta
    NM_001282543.1.fasta	XM_005249642.1.fasta	XR_241080.1.fasta
    NM_001282545.1.fasta	XM_005249643.1.fasta	XR_241081.1.fasta
    NM_001282548.1.fasta	XM_005249644.1.fasta

    $ faidx --delimiter='_' tests/data/genes.fasta 000465.3
    >000465.3
    CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
    AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
    .......

    $ faidx --size-range 5500,6000 -i chromsizes tests/data/genes.fasta
    NM_000465.3	5523

    $ faidx -m --bed regions.bed tests/data/genes.fasta
    ### Modifies tests/data/genes.fasta by masking regions using --default-seq character ###

    $ faidx -M --bed regions.bed tests/data/genes.fasta
    ### Modifies tests/data/genes.fasta by masking regions using lowercase characters ###

    $ faidx -e "lambda x: x.split('.')[0]" tests/data/genes.fasta -i bed
    AB821309	1	3510
    KF435150	1	481
    KF435149	1	642
    NR_104216	1	4573
    NR_104215	1	5317
    .......


Similar syntax as ``samtools faidx``


A lower-level Faidx class is also available:

.. code:: python

    >>> from pyfaidx import Faidx
    >>> fa = Faidx('genes.fa')  # can return str with as_raw=True
    >>> fa.index
    OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])

    >>> fa.index['AB821309.1'].rlen
    3510

    fa.fetch('AB821309.1', 1, 10)  # these are 1-based genomic coordinates
    >AB821309.1:1-10
    ATGGTCAGCT


-  If the FASTA file is not indexed, when ``Faidx`` is initialized the
   ``build_index`` method will automatically run, and
   the index will be written to "filename.fa.fai" with ``write_fai()``.
   where "filename.fa" is the original FASTA file.
-  Start and end coordinates are 1-based.

Support for compressed FASTA
----------------------------

``pyfaidx`` can create and read ``.fai`` indices for FASTA files that have
been compressed using the `bgzip <https://www.htslib.org/doc/bgzip.html>`_
tool from `samtools <http://www.htslib.org/>`_. ``bgzip`` writes compressed
data in a ``BGZF`` format. ``BGZF`` is ``gzip`` compatible, consisting of
multiple concatenated ``gzip`` blocks, each with an additional ``gzip``
header making it possible to build an index for rapid random access. I.e.,
files compressed with ``bgzip`` are valid ``gzip`` and so can be read by
``gunzip``.  See `this description
<http://pydoc.net/Python/biopython/1.66/Bio.bgzf/>`_ for more details on
``bgzip``.

Changelog
---------

Please see the `releases <https://github.com/mdshw5/pyfaidx/releases>`_ for a
comprehensive list of version changes.

Known issues
------------

I try to fix as many bugs as possible, but most of this work is supported by a single developer. Please check the `known issues <https://github.com/mdshw5/pyfaidx/issues?utf8=✓&q=is%3Aissue+is%3Aopen+label%3Aknown>`_ for bugs relevant to your work. Pull requests are welcome.


Contributing
------------

Create a new Pull Request with one feature. If you add a new feature, please
create also the relevant test.

To get test running on your machine:
 - Create a new virtualenv and install the `dev-requirements.txt`.
 
      pip install -r dev-requirements.txt
      
 - Download the test data running:

      python tests/data/download_gene_fasta.py

 - Run the tests with

      pytests

Acknowledgements
----------------

This project is freely licensed by the author, `Matthew
Shirley <http://mattshirley.com>`_, and was completed under the
mentorship and financial support of Drs. `Sarah
Wheelan <http://sjwheelan.som.jhmi.edu>`_ and `Vasan
Yegnasubramanian <http://yegnalab.onc.jhmi.edu>`_ at the Sidney Kimmel
Comprehensive Cancer Center in the Department of Oncology.

.. |Travis| image:: https://travis-ci.com/mdshw5/pyfaidx.svg?branch=master
    :target: https://travis-ci.com/mdshw5/pyfaidx
    
.. |CI| image:: https://github.com/mdshw5/pyfaidx/actions/workflows/main.yml/badge.svg?branch=master
    :target: https://github.com/mdshw5/pyfaidx/actions/workflows/main.yml

.. |PyPI| image:: https://img.shields.io/pypi/v/pyfaidx.svg?branch=master
    :target: https://pypi.python.org/pypi/pyfaidx

.. |Landscape| image:: https://landscape.io/github/mdshw5/pyfaidx/master/landscape.svg
   :target: https://landscape.io/github/mdshw5/pyfaidx/master
   :alt: Code Health

.. |Coverage| image:: https://codecov.io/gh/mdshw5/pyfaidx/branch/master/graph/badge.svg
   :target: https://codecov.io/gh/mdshw5/pyfaidx

.. |Depsy| image:: http://depsy.org/api/package/pypi/pyfaidx/badge.svg
   :target: http://depsy.org/package/python/pyfaidx

.. |Appveyor| image:: https://ci.appveyor.com/api/projects/status/80ihlw30a003596w?svg=true
   :target: https://ci.appveyor.com/project/mdshw5/pyfaidx
   
.. |Package| image:: https://github.com/mdshw5/pyfaidx/actions/workflows/pypi.yml/badge.svg
   :target: https://github.com/mdshw5/pyfaidx/actions/workflows/pypi.yml
   
.. |Downloads| image:: https://img.shields.io/pypi/dm/pyfaidx.svg
   :target: https://pypi.python.org/pypi/pyfaidx/

            

Raw data

            {
    "_id": null,
    "home_page": null,
    "name": "pyfaidx",
    "maintainer": null,
    "docs_url": "https://pythonhosted.org/pyfaidx/",
    "requires_python": ">=3.7",
    "maintainer_email": null,
    "keywords": null,
    "author": null,
    "author_email": "Matthew Shirley <mdshw5@gmail.com>",
    "download_url": "https://files.pythonhosted.org/packages/87/d6/0f18dc8e96b6fbf3a11e79aad2b14403073f50f296cfe90b0a068748f259/pyfaidx-0.9.0.2.tar.gz",
    "platform": null,
    "description": "|CI| |Package| |PyPI| |Coverage| |Downloads|\n\nDescription\n-----------\n\nSamtools provides a function \"faidx\" (FAsta InDeX), which creates a\nsmall flat index file \".fai\" allowing for fast random access to any\nsubsequence in the indexed FASTA file, while loading a minimal amount of the\nfile in to memory. This python module implements pure Python classes for\nindexing, retrieval, and in-place modification of FASTA files using a samtools\ncompatible index. The pyfaidx module is API compatible with the `pygr`_ seqdb module.\nA command-line script \"`faidx`_\" is installed alongside the pyfaidx module, and\nfacilitates complex manipulation of FASTA files without any programming knowledge.\n\n.. _`pygr`: https://github.com/cjlee112/pygr\n\nIf you use pyfaidx in your publication, please cite:\n\n`Shirley MD`_, `Ma Z`_, `Pedersen B`_, `Wheelan S`_. `Efficient \"pythonic\" access to FASTA files using pyfaidx <https://dx.doi.org/10.7287/peerj.preprints.970v1>`_. PeerJ PrePrints 3:e1196. 2015.\n\n.. _`Shirley MD`: http://github.com/mdshw5\n.. _`Ma Z`: http://github.com/azalea\n.. _`Pedersen B`: http://github.com/brentp\n.. _`Wheelan S`: http://github.com/swheelan\n\nInstallation\n------------\n\nThis package is tested under Linux and macOS using Python 3.7+, and and is available from the PyPI:\n\n::\n\n    pip install pyfaidx  # add --user if you don't have root\n\nor download a `release <https://github.com/mdshw5/pyfaidx/releases>`_ and:\n\n::\n\n    pip install .\n\nIf using ``pip install --user`` make sure to add ``/home/$USER/.local/bin`` to your ``$PATH`` (on linux) or ``/Users/$USER/Library/Python/{python version}/bin`` (on macOS) if you want to run the ``faidx`` script.\n\nPython 2.6 and 2.7 users may choose to use a package version from `v0.7.2 <https://github.com/mdshw5/pyfaidx/releases/tag/v0.7.2.2>`_ or earier.\n\nUsage\n-----\n\n.. code:: python\n\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta')\n    >>> genes\n    Fasta(\"tests/data/genes.fasta\")  # set strict_bounds=True for bounds checking\n\nActs like a dictionary.\n\n.. code:: python\n\n    >>> genes.keys()\n    ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')\n\n    >>> genes['NM_001282543.1'][200:230]\n    >NM_001282543.1:201-230\n    CTCGTTCCGCGCCCGCCATGGAACCGGATG\n\n    >>> genes['NM_001282543.1'][200:230].seq\n    'CTCGTTCCGCGCCCGCCATGGAACCGGATG'\n\n    >>> genes['NM_001282543.1'][200:230].name\n    'NM_001282543.1'\n\n    # Start attributes are 1-based\n    >>> genes['NM_001282543.1'][200:230].start\n    201\n\n    # End attributes are 0-based\n    >>> genes['NM_001282543.1'][200:230].end\n    230\n\n    >>> genes['NM_001282543.1'][200:230].fancy_name\n    'NM_001282543.1:201-230'\n\n    >>> len(genes['NM_001282543.1'])\n    5466\n\nNote that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``. This argument only affects the ``Sequence .start/.end`` attributes, and has no effect on slicing coordinates.\n\nIndexes like a list:\n\n.. code:: python\n\n    >>> genes[0][:50]\n    >AB821309.1:1-50\n    ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC\n\nSlices just like a string:\n\n.. code:: python\n\n    >>> genes['NM_001282543.1'][200:230][:10]\n    >NM_001282543.1:201-210\n    CTCGTTCCGC\n\n    >>> genes['NM_001282543.1'][200:230][::-1]\n    >NM_001282543.1:230-201\n    GTAGGCCAAGGTACCGCCCGCGCCTTGCTC\n\n    >>> genes['NM_001282543.1'][200:230][::3]\n    >NM_001282543.1:201-230\n    CGCCCCTACA\n\n    >>> genes['NM_001282543.1'][:]\n    >NM_001282543.1:1-5466\n    CCCCGCCCCT........\n\n- Slicing start and end coordinates are 0-based, just like Python sequences.\n\nComplements and reverse complements just like DNA\n\n.. code:: python\n\n    >>> genes['NM_001282543.1'][200:230].complement\n    >NM_001282543.1 (complement):201-230\n    GAGCAAGGCGCGGGCGGTACCTTGGCCTAC\n\n    >>> genes['NM_001282543.1'][200:230].reverse\n    >NM_001282543.1:230-201\n    GTAGGCCAAGGTACCGCCCGCGCCTTGCTC\n\n    >>> -genes['NM_001282543.1'][200:230]\n    >NM_001282543.1 (complement):230-201\n    CATCCGGTTCCATGGCGGGCGCGGAACGAG\n\n``Fasta`` objects can also be accessed using method calls:\n\n.. code:: python\n\n    >>> genes.get_seq('NM_001282543.1', 201, 210)\n    >NM_001282543.1:201-210\n    CTCGTTCCGC\n\n    >>> genes.get_seq('NM_001282543.1', 201, 210, rc=True)\n    >NM_001282543.1 (complement):210-201\n    GCGGAACGAG\n\nSpliced sequences can be retrieved from a list of [start, end] coordinates:\n**TODO** update this section\n\n.. code:: python\n\n    # new in v0.5.1\n    segments = [[1, 10], [50, 70]]\n    >>> genes.get_spliced_seq('NM_001282543.1', segments)\n    >gi|543583786|ref|NM_001282543.1|:1-70\n    CCCCGCCCCTGGTTTCGAGTCGCTGGCCTGC\n\n.. _keyfn:\n\nCustom key functions provide cleaner access:\n\n.. code:: python\n\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])\n    >>> genes.keys()\n    dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])\n    >>> genes['NR_104212'][:10]\n    >NR_104212:1-10\n    CCCCGCCCCT\n\nYou can specify a character to split names on, which will generate additional entries:\n\n.. code:: python\n\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta', split_char='.', duplicate_action=\"first\") # default duplicate_action=\"stop\"\n    >>> genes.keys()\n    dict_keys(['.1', 'NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])\n\nIf your `key_function` or `split_char` generates duplicate entries, you can choose what action to take:\n\n.. code:: python\n\n    # new in v0.4.9\n    >>> genes = Fasta('tests/data/genes.fasta', split_char=\"|\", duplicate_action=\"longest\")\n    >>> genes.keys()\n    dict_keys(['gi', '563317589', 'dbj', 'AB821309.1', '', '557361099', 'gb', 'KF435150.1', '557361097', 'KF435149.1', '543583796', 'ref', 'NR_104216.1', '543583795', 'NR_104215.1', '543583794', 'NR_104212.1', '543583788', 'NM_001282545.1', '543583786', 'NM_001282543.1', '543583785', 'NM_000465.3', '543583740', 'NM_001282549.1', '543583738', 'NM_001282548.1', '530384540', 'XM_005249645.1', '530384538', 'XM_005249644.1', '530384536', 'XM_005249643.1', '530384534', 'XM_005249642.1', '530373237','XM_005265508.1', '530373235', 'XM_005265507.1', '530364726', 'XR_241081.1', '530364725', 'XR_241080.1', '530364724', 'XR_241079.1'])\n\nFilter functions (returning True) limit the index:\n\n.. code:: python\n\n    # new in v0.3.8\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta', filt_function = lambda x: x[0] == 'N')\n    >>> genes.keys()\n    dict_keys(['NR_104212', 'NM_001282543', 'NR_104216', 'NR_104215', 'NM_001282549', 'NM_000465', 'NM_001282545', 'NM_001282548'])\n    >>> genes['XM_005249644']\n    KeyError: XM_005249644 not in tests/data/genes.fasta.\n\nOr just get a Python string:\n\n.. code:: python\n\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta', as_raw=True)\n    >>> genes\n    Fasta(\"tests/data/genes.fasta\", as_raw=True)\n\n    >>> genes['NM_001282543.1'][200:230]\n    CTCGTTCCGCGCCCGCCATGGAACCGGATG\n\nYou can make sure that you always receive an uppercase sequence, even if your fasta file has lower case\n\n.. code:: python\n\n    >>> from pyfaidx import Fasta\n    >>> reference = Fasta('tests/data/genes.fasta.lower', sequence_always_upper=True)\n    >>> reference['gi|557361099|gb|KF435150.1|'][1:70]\n\n    >gi|557361099|gb|KF435150.1|:2-70\n    TGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA\n\n\nYou can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:\n\n.. code:: python\n\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta')\n    >>> for line in genes['NM_001282543.1']:\n    ...   print(line)\n    CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC\n    AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA\n    CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC\n    ...\n\nSequence names are truncated on any whitespace. This is a limitation of the indexing strategy. However, full names can be recovered:\n\n.. code:: python\n\n    # new in v0.3.7\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta')\n    >>> for record in genes:\n    ...   print(record.name)\n    ...   print(record.long_name)\n    ...\n    gi|563317589|dbj|AB821309.1|\n    gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds\n    gi|557361099|gb|KF435150.1|\n    gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced\n    gi|557361097|gb|KF435149.1|\n    gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds\n    ...\n\n    # new in v0.4.9\n    >>> from pyfaidx import Fasta\n    >>> genes = Fasta('tests/data/genes.fasta', read_long_names=True)\n    >>> for record in genes:\n    ...   print(record.name)\n    ...\n    gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds\n    gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced\n    gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds\n\nRecords can be accessed efficiently as numpy arrays:\n\n.. code:: python\n\n    # new in v0.5.4\n    >>> from pyfaidx import Fasta\n    >>> import numpy as np\n    >>> genes = Fasta('tests/data/genes.fasta')\n    >>> np.asarray(genes['NM_001282543.1'])\n    array(['C', 'C', 'C', ..., 'A', 'A', 'A'], dtype='|S1')\n\nSequence can be buffered in memory using a read-ahead buffer\nfor fast sequential access:\n\n.. code:: python\n\n    >>> from timeit import timeit\n    >>> fetch = \"genes['NM_001282543.1'][200:230]\"\n    >>> read_ahead = \"import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta', read_ahead=10000)\"\n    >>> no_read_ahead = \"import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta')\"\n    >>> string_slicing = \"genes = {}; genes['NM_001282543.1'] = 'N'*10000\"\n\n    >>> timeit(fetch, no_read_ahead, number=10000)\n    0.2204863309962093\n    >>> timeit(fetch, read_ahead, number=10000)\n    0.1121859749982832\n    >>> timeit(fetch, string_slicing, number=10000)\n    0.0033553699977346696\n\nRead-ahead buffering can reduce runtime by 1/2 for sequential accesses to buffered regions.\n\n.. role:: red\n\nIf you want to modify the contents of your FASTA file in-place, you can use the `mutable` argument.\nAny portion of the FastaRecord can be replaced with an equivalent-length string.\n:red:`Warning`: *This will change the contents of your file immediately and permanently:*\n\n.. code:: python\n\n    >>> genes = Fasta('tests/data/genes.fasta', mutable=True)\n    >>> type(genes['NM_001282543.1'])\n    <class 'pyfaidx.MutableFastaRecord'>\n\n    >>> genes['NM_001282543.1'][:10]\n    >NM_001282543.1:1-10\n    CCCCGCCCCT\n    >>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'\n    >>> genes['NM_001282543.1'][:15]\n    >NM_001282543.1:1-15\n    NNNNNNNNNNCTGGC\n\nThe FastaVariant class provides a way to integrate single nucleotide variant calls to generate a consensus sequence.\n\n.. code:: python\n\n    # new in v0.4.0\n    >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', het=True, hom=True)\n    RuntimeWarning: Using sample NA06984 genotypes.\n\n    >>> consensus['22'].variant_sites\n    (16042793, 21833121, 29153196, 29187373, 29187448, 29194610, 29821295, 29821332, 29993842, 32330460, 32352284)\n\n    >>> consensus['22'][16042790:16042800]\n    >22:16042791-16042800\n    TCGTAGGACA\n\n    >>> Fasta('tests/data/chr22.fasta')['22'][16042790:16042800]\n    >22:16042791-16042800\n    TCATAGGACA\n\n    >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', sample='NA06984', het=True, hom=True, call_filter='GT == \"0/1\"')\n    >>> consensus['22'].variant_sites\n    (16042793, 29187373, 29187448, 29194610, 29821332)\n    \nYou can also specify paths using ``pathlib.Path`` objects.\n\n.. code:: python\n    \n    #new in v0.7.1\n    >>> from pyfaidx import Fasta\n    >>> from pathlib import Path\n    >>> genes = Fasta(Path('tests/data/genes.fasta'))\n    >>> genes\n    Fasta(\"tests/data/genes.fasta\")\n\nAccessing fasta files from `filesystem_spec <https://filesystem-spec.readthedocs.io>`_ filesystems:\n\n.. code:: python\n\n    # new in v0.7.0\n    # pip install fsspec s3fs\n    >>> import fsspec\n    >>> from pyfaidx import Fasta\n    >>> of = fsspec.open(\"s3://broad-references/hg19/v0/Homo_sapiens_assembly19.fasta\", anon=True)\n    >>> genes = Fasta(of)\n\n\n.. _faidx:\n\nIt also provides a command-line script:\n\ncli script: faidx\n~~~~~~~~~~~~~~~~~\n\n.. code:: bash\n\n    Fetch sequences from FASTA. If no regions are specified, all entries in the\n    input file are returned. Input FASTA file must be consistently line-wrapped,\n    and line wrapping of output is based on input line lengths.\n\n    positional arguments:\n      fasta                 FASTA file\n      regions               space separated regions of sequence to fetch e.g.\n                            chr1:1-1000\n\n    optional arguments:\n      -h, --help            show this help message and exit\n      -b BED, --bed BED     bed file of regions (zero-based start coordinate)\n      -o OUT, --out OUT     output file name (default: stdout)\n      -i {bed,chromsizes,nucleotide,transposed}, --transform {bed,chromsizes,nucleotide,transposed} transform the requested regions into another format. default: None\n      -c, --complement      complement the sequence. default: False\n      -r, --reverse         reverse the sequence. default: False\n      -a SIZE_RANGE, --size-range SIZE_RANGE\n                            selected sequences are in the size range [low, high]. example: 1,1000 default: None\n      -n, --no-names        omit sequence names from output. default: False\n      -f, --full-names      output full names including description. default: False\n      -x, --split-files     write each region to a separate file (names are derived from regions)\n      -l, --lazy            fill in --default-seq for missing ranges. default: False\n      -s DEFAULT_SEQ, --default-seq DEFAULT_SEQ\n                            default base for missing positions and masking. default: None\n      -d DELIMITER, --delimiter DELIMITER\n                            delimiter for splitting names to multiple values (duplicate names will be discarded). default: None\n      -e HEADER_FUNCTION, --header-function HEADER_FUNCTION\n                            python function to modify header lines e.g: \"lambda x: x.split(\"|\")[0]\". default: lambda x: x.split()[0]\n      -u {stop,first,last,longest,shortest}, --duplicates-action {stop,first,last,longest,shortest}\n                            entry to take when duplicate sequence names are encountered. default: stop\n      -g REGEX, --regex REGEX\n                            selected sequences are those matching regular expression. default: .*\n      -v, --invert-match    selected sequences are those not matching 'regions' argument. default: False\n      -m, --mask-with-default-seq\n                            mask the FASTA file using --default-seq default: False\n      -M, --mask-by-case    mask the FASTA file by changing to lowercase. default: False\n      -e HEADER_FUNCTION, --header-function HEADER_FUNCTION\n                            python function to modify header lines e.g: \"lambda x: x.split(\"|\")[0]\". default: None\n      --no-rebuild          do not rebuild the .fai index even if it is out of date. default: False\n      --version             print pyfaidx version number\n\nExamples:\n\n.. code:: bash\n\n    $ faidx -v tests/data/genes.fasta\n    ### Creates an .fai index, but supresses sequence output using --invert-match ###\n\n    $ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320\n    >NM_001282543.1:201-210\n    CTCGTTCCGC\n    >NM_001282543.1:300-320\n    GTAATTGTGTAAGTGACTGCA\n\n    $ faidx --full-names tests/data/genes.fasta NM_001282543.1:201-210\n    >NM_001282543.1| Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant 2, mRNA\n    CTCGTTCCGC\n\n    $ faidx --no-names tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320\n    CTCGTTCCGC\n    GTAATTGTGTAAGTGACTGCA\n\n    $ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210\n    >NM_001282543.1:201-210 (complement)\n    GAGCAAGGCG\n\n    $ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210\n    >NM_001282543.1:210-201\n    CGCCTTGCTC\n\n    $ faidx --reverse --complement tests/data/genes.fasta NM_001282543.1:201-210\n    >NM_001282543.1:210-201 (complement)\n    GCGGAACGAG\n\n    $ faidx tests/data/genes.fasta NM_001282543.1\n    >NM_001282543.1:1-5466\n    CCCCGCCCCT........\n    ..................\n    ..................\n    ..................\n\n    $ faidx --regex \"^NM_00128254[35]\" genes.fasta\n    >NM_001282543.1\n    ..................\n    ..................\n    ..................\n    >NM_001282545.1\n    ..................\n    ..................\n    ..................\n\n    $ faidx --lazy tests/data/genes.fasta NM_001282543.1:5460-5480\n    >NM_001282543.1:5460-5480\n    AAAAAAANNNNNNNNNNNNNN\n\n    $ faidx --lazy --default-seq='Q' tests/data/genes.fasta NM_001282543.1:5460-5480\n    >NM_001282543.1:5460-5480\n    AAAAAAAQQQQQQQQQQQQQQ\n\n    $ faidx tests/data/genes.fasta --bed regions.bed\n    ...\n\n    $ faidx --transform chromsizes tests/data/genes.fasta\n    AB821309.1\t3510\n    KF435150.1\t481\n    KF435149.1\t642\n    NR_104216.1\t4573\n    NR_104215.1\t5317\n    NR_104212.1\t5374\n    ...\n\n    $ faidx --transform bed tests/data/genes.fasta\n    AB821309.1\t1    3510\n    KF435150.1\t1    481\n    KF435149.1\t1    642\n    NR_104216.1\t1   4573\n    NR_104215.1\t1   5317\n    NR_104212.1\t1   5374\n    ...\n\n    $ faidx --transform nucleotide tests/data/genes.fasta\n    name\tstart\tend\tA\tT\tC\tG\tN\n    AB821309.1\t1\t3510\t955\t774\t837\t944\t0\n    KF435150.1\t1\t481\t149\t120\t103\t109\t0\n    KF435149.1\t1\t642\t201\t163\t129\t149\t0\n    NR_104216.1\t1\t4573\t1294\t1552\t828\t899\t0\n    NR_104215.1\t1\t5317\t1567\t1738\t968\t1044\t0\n    NR_104212.1\t1\t5374\t1581\t1756\t977\t1060\t0\n    ...\n\n    faidx --transform transposed tests/data/genes.fasta\n    AB821309.1\t1\t3510\tATGGTCAGCTGGGGTCGTTTCATC...\n    KF435150.1\t1\t481\tATGACATCATTTTCCACCTCTGCT...\n    KF435149.1\t1\t642\tATGACATCATTTTCCACCTCTGCT...\n    NR_104216.1\t1\t4573\tCCCCGCCCCTCTGGCGGCCCGCCG...\n    NR_104215.1\t1\t5317\tCCCCGCCCCTCTGGCGGCCCGCCG...\n    NR_104212.1\t1\t5374\tCCCCGCCCCTCTGGCGGCCCGCCG...\n    ...\n\n    $ faidx --split-files tests/data/genes.fasta\n    $ ls\n    AB821309.1.fasta\tNM_001282549.1.fasta\tXM_005249645.1.fasta\n    KF435149.1.fasta\tNR_104212.1.fasta\tXM_005265507.1.fasta\n    KF435150.1.fasta\tNR_104215.1.fasta\tXM_005265508.1.fasta\n    NM_000465.3.fasta\tNR_104216.1.fasta\tXR_241079.1.fasta\n    NM_001282543.1.fasta\tXM_005249642.1.fasta\tXR_241080.1.fasta\n    NM_001282545.1.fasta\tXM_005249643.1.fasta\tXR_241081.1.fasta\n    NM_001282548.1.fasta\tXM_005249644.1.fasta\n\n    $ faidx --delimiter='_' tests/data/genes.fasta 000465.3\n    >000465.3\n    CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC\n    AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA\n    .......\n\n    $ faidx --size-range 5500,6000 -i chromsizes tests/data/genes.fasta\n    NM_000465.3\t5523\n\n    $ faidx -m --bed regions.bed tests/data/genes.fasta\n    ### Modifies tests/data/genes.fasta by masking regions using --default-seq character ###\n\n    $ faidx -M --bed regions.bed tests/data/genes.fasta\n    ### Modifies tests/data/genes.fasta by masking regions using lowercase characters ###\n\n    $ faidx -e \"lambda x: x.split('.')[0]\" tests/data/genes.fasta -i bed\n    AB821309\t1\t3510\n    KF435150\t1\t481\n    KF435149\t1\t642\n    NR_104216\t1\t4573\n    NR_104215\t1\t5317\n    .......\n\n\nSimilar syntax as ``samtools faidx``\n\n\nA lower-level Faidx class is also available:\n\n.. code:: python\n\n    >>> from pyfaidx import Faidx\n    >>> fa = Faidx('genes.fa')  # can return str with as_raw=True\n    >>> fa.index\n    OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])\n\n    >>> fa.index['AB821309.1'].rlen\n    3510\n\n    fa.fetch('AB821309.1', 1, 10)  # these are 1-based genomic coordinates\n    >AB821309.1:1-10\n    ATGGTCAGCT\n\n\n-  If the FASTA file is not indexed, when ``Faidx`` is initialized the\n   ``build_index`` method will automatically run, and\n   the index will be written to \"filename.fa.fai\" with ``write_fai()``.\n   where \"filename.fa\" is the original FASTA file.\n-  Start and end coordinates are 1-based.\n\nSupport for compressed FASTA\n----------------------------\n\n``pyfaidx`` can create and read ``.fai`` indices for FASTA files that have\nbeen compressed using the `bgzip <https://www.htslib.org/doc/bgzip.html>`_\ntool from `samtools <http://www.htslib.org/>`_. ``bgzip`` writes compressed\ndata in a ``BGZF`` format. ``BGZF`` is ``gzip`` compatible, consisting of\nmultiple concatenated ``gzip`` blocks, each with an additional ``gzip``\nheader making it possible to build an index for rapid random access. I.e.,\nfiles compressed with ``bgzip`` are valid ``gzip`` and so can be read by\n``gunzip``.  See `this description\n<http://pydoc.net/Python/biopython/1.66/Bio.bgzf/>`_ for more details on\n``bgzip``.\n\nChangelog\n---------\n\nPlease see the `releases <https://github.com/mdshw5/pyfaidx/releases>`_ for a\ncomprehensive list of version changes.\n\nKnown issues\n------------\n\nI try to fix as many bugs as possible, but most of this work is supported by a single developer. Please check the `known issues <https://github.com/mdshw5/pyfaidx/issues?utf8=\u2713&q=is%3Aissue+is%3Aopen+label%3Aknown>`_ for bugs relevant to your work. Pull requests are welcome.\n\n\nContributing\n------------\n\nCreate a new Pull Request with one feature. If you add a new feature, please\ncreate also the relevant test.\n\nTo get test running on your machine:\n - Create a new virtualenv and install the `dev-requirements.txt`.\n \n      pip install -r dev-requirements.txt\n      \n - Download the test data running:\n\n      python tests/data/download_gene_fasta.py\n\n - Run the tests with\n\n      pytests\n\nAcknowledgements\n----------------\n\nThis project is freely licensed by the author, `Matthew\nShirley <http://mattshirley.com>`_, and was completed under the\nmentorship and financial support of Drs. `Sarah\nWheelan <http://sjwheelan.som.jhmi.edu>`_ and `Vasan\nYegnasubramanian <http://yegnalab.onc.jhmi.edu>`_ at the Sidney Kimmel\nComprehensive Cancer Center in the Department of Oncology.\n\n.. |Travis| image:: https://travis-ci.com/mdshw5/pyfaidx.svg?branch=master\n    :target: https://travis-ci.com/mdshw5/pyfaidx\n    \n.. |CI| image:: https://github.com/mdshw5/pyfaidx/actions/workflows/main.yml/badge.svg?branch=master\n    :target: https://github.com/mdshw5/pyfaidx/actions/workflows/main.yml\n\n.. |PyPI| image:: https://img.shields.io/pypi/v/pyfaidx.svg?branch=master\n    :target: https://pypi.python.org/pypi/pyfaidx\n\n.. |Landscape| image:: https://landscape.io/github/mdshw5/pyfaidx/master/landscape.svg\n   :target: https://landscape.io/github/mdshw5/pyfaidx/master\n   :alt: Code Health\n\n.. |Coverage| image:: https://codecov.io/gh/mdshw5/pyfaidx/branch/master/graph/badge.svg\n   :target: https://codecov.io/gh/mdshw5/pyfaidx\n\n.. |Depsy| image:: http://depsy.org/api/package/pypi/pyfaidx/badge.svg\n   :target: http://depsy.org/package/python/pyfaidx\n\n.. |Appveyor| image:: https://ci.appveyor.com/api/projects/status/80ihlw30a003596w?svg=true\n   :target: https://ci.appveyor.com/project/mdshw5/pyfaidx\n   \n.. |Package| image:: https://github.com/mdshw5/pyfaidx/actions/workflows/pypi.yml/badge.svg\n   :target: https://github.com/mdshw5/pyfaidx/actions/workflows/pypi.yml\n   \n.. |Downloads| image:: https://img.shields.io/pypi/dm/pyfaidx.svg\n   :target: https://pypi.python.org/pypi/pyfaidx/\n",
    "bugtrack_url": null,
    "license": "BSD-3-Clause",
    "summary": "pyfaidx: efficient pythonic random access to fasta subsequences",
    "version": "0.9.0.2",
    "project_urls": {
        "Author homepage": "http://mattshirley.com",
        "Homepage": "https://github.com/mdshw5/pyfaidx/"
    },
    "split_keywords": [],
    "urls": [
        {
            "comment_text": null,
            "digests": {
                "blake2b_256": "d548269a8332d4c8aa470302a05a4b5f3821a139b2cb88347fd364030bfc86d6",
                "md5": "3f95ddd8a909187ecb10181fda7bc4f4",
                "sha256": "f58f407d9f28f081e1b0a43ec7229526cadf3ea2edda65f577c497a97bf57577"
            },
            "downloads": -1,
            "filename": "pyfaidx-0.9.0.2-py3-none-any.whl",
            "has_sig": false,
            "md5_digest": "3f95ddd8a909187ecb10181fda7bc4f4",
            "packagetype": "bdist_wheel",
            "python_version": "py3",
            "requires_python": ">=3.7",
            "size": 29380,
            "upload_time": "2025-09-03T01:45:13",
            "upload_time_iso_8601": "2025-09-03T01:45:13.455649Z",
            "url": "https://files.pythonhosted.org/packages/d5/48/269a8332d4c8aa470302a05a4b5f3821a139b2cb88347fd364030bfc86d6/pyfaidx-0.9.0.2-py3-none-any.whl",
            "yanked": false,
            "yanked_reason": null
        },
        {
            "comment_text": null,
            "digests": {
                "blake2b_256": "87d60f18dc8e96b6fbf3a11e79aad2b14403073f50f296cfe90b0a068748f259",
                "md5": "3ab48508feb127a4fce91f772dc410cb",
                "sha256": "aa29dc620baea49c166741b59a97675ae006ed81f194c77908d06817ec0d0bd7"
            },
            "downloads": -1,
            "filename": "pyfaidx-0.9.0.2.tar.gz",
            "has_sig": false,
            "md5_digest": "3ab48508feb127a4fce91f772dc410cb",
            "packagetype": "sdist",
            "python_version": "source",
            "requires_python": ">=3.7",
            "size": 70909,
            "upload_time": "2025-09-03T01:45:14",
            "upload_time_iso_8601": "2025-09-03T01:45:14.601431Z",
            "url": "https://files.pythonhosted.org/packages/87/d6/0f18dc8e96b6fbf3a11e79aad2b14403073f50f296cfe90b0a068748f259/pyfaidx-0.9.0.2.tar.gz",
            "yanked": false,
            "yanked_reason": null
        }
    ],
    "upload_time": "2025-09-03 01:45:14",
    "github": true,
    "gitlab": false,
    "bitbucket": false,
    "codeberg": false,
    "github_user": "mdshw5",
    "github_project": "pyfaidx",
    "travis_ci": false,
    "coveralls": true,
    "github_actions": true,
    "lcname": "pyfaidx"
}
        
Elapsed time: 1.59312s