[](https://huggingface.co/spaces/z-uo/DNASequenceVisualization)
# Streamlit seqviz
This library is a streamlit app for chemical or medical use that show DNA sequences effectively based on [seqviz](https://github.com/Lattice-Automation/seqviz) js library.
|white theme | dark theme |
|------------|------------|
|||
Install with:
```bash
pip install streamlit-seqviz
```
Usage example:
```python
from streamlit_seqviz import streamlit_seqviz
streamlit_seqviz(
name = "J23100",
seq = "TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
annotations = [{ "name": "promoter", "start": 0, "end": 30, "direction": 1 }],
style = { "height": "100vh", "width": "100vw" },
highlights = [{ "start": 0, "end": 10 }],
enzymes = [
"EcoRI",
"PstI",
{
"name": "Cas9",
"rseq": "NGG", # recognition sequence
"fcut": 0, # cut index on FWD strand, relative to start of rseq
"rcut": 1, # cut index on REV strand, relative to start of rseq
"color": "#D7E5F0", # color to highlight recognition site with
"range": {
"start": 4,
"end": 8,
},
},
],
)
```
Raw data
{
"_id": null,
"home_page": "https://gitlab.com/nicolalandro/streamlit-seqviz",
"name": "streamlit-seqviz",
"maintainer": "",
"docs_url": null,
"requires_python": ">=3.6",
"maintainer_email": "",
"keywords": "dna,streamlit,chemistry",
"author": "Nicola Landro",
"author_email": "nicolaxx94@live.it",
"download_url": "https://files.pythonhosted.org/packages/b4/68/cd9de060753cef3ef9e23cbc79163f1d8db4d53fba30e0dcf151cc02e33e/streamlit-seqviz-0.0.5.tar.gz",
"platform": null,
"description": "[](https://huggingface.co/spaces/z-uo/DNASequenceVisualization)\n\n# Streamlit seqviz\n\nThis library is a streamlit app for chemical or medical use that show DNA sequences effectively based on [seqviz](https://github.com/Lattice-Automation/seqviz) js library.\n\n|white theme | dark theme |\n|------------|------------|\n|||\n\nInstall with:\n\n```bash\npip install streamlit-seqviz\n```\n\nUsage example:\n\n```python\nfrom streamlit_seqviz import streamlit_seqviz\n\nstreamlit_seqviz(\n name = \"J23100\",\n seq = \"TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC\",\n annotations = [{ \"name\": \"promoter\", \"start\": 0, \"end\": 30, \"direction\": 1 }],\n style = { \"height\": \"100vh\", \"width\": \"100vw\" },\n highlights = [{ \"start\": 0, \"end\": 10 }],\n enzymes = [\n \"EcoRI\",\n \"PstI\",\n {\n \"name\": \"Cas9\",\n \"rseq\": \"NGG\", # recognition sequence\n \"fcut\": 0, # cut index on FWD strand, relative to start of rseq\n \"rcut\": 1, # cut index on REV strand, relative to start of rseq\n \"color\": \"#D7E5F0\", # color to highlight recognition site with\n \"range\": {\n \"start\": 4,\n \"end\": 8,\n },\n },\n ],\n)\n```\n\n\n\n\n",
"bugtrack_url": null,
"license": "",
"summary": "This library is a streamlit app for chemical or medical use that show DNA sequences effectively",
"version": "0.0.5",
"project_urls": {
"Homepage": "https://gitlab.com/nicolalandro/streamlit-seqviz",
"Source": "https://gitlab.com/nicolalandro/streamlit-seqviz"
},
"split_keywords": [
"dna",
"streamlit",
"chemistry"
],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "b468cd9de060753cef3ef9e23cbc79163f1d8db4d53fba30e0dcf151cc02e33e",
"md5": "51cd2469cf4d54a77d70f76f76eaf881",
"sha256": "c5d4965546c2394b576c158b05a6c68890d60de3d566d539325e344c6498f200"
},
"downloads": -1,
"filename": "streamlit-seqviz-0.0.5.tar.gz",
"has_sig": false,
"md5_digest": "51cd2469cf4d54a77d70f76f76eaf881",
"packagetype": "sdist",
"python_version": "source",
"requires_python": ">=3.6",
"size": 60998,
"upload_time": "2023-05-22T07:57:23",
"upload_time_iso_8601": "2023-05-22T07:57:23.673721Z",
"url": "https://files.pythonhosted.org/packages/b4/68/cd9de060753cef3ef9e23cbc79163f1d8db4d53fba30e0dcf151cc02e33e/streamlit-seqviz-0.0.5.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2023-05-22 07:57:23",
"github": false,
"gitlab": true,
"bitbucket": false,
"codeberg": false,
"gitlab_user": "nicolalandro",
"gitlab_project": "streamlit-seqviz",
"lcname": "streamlit-seqviz"
}