Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data
===========================================================================================
Taxoniq is a Python and command-line interface to the
[NCBI Taxonomy database](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408187/) and selected data sources that
cross-reference it.
Taxoniq's features include:
- Pre-computed indexes updated monthly from NCBI, [WoL](https://biocore.github.io/wol/) and cross-referenced databases
- Offline operation: all indexes are bundled with the package; no network calls are made when querying taxon information
(separately, Taxoniq can fetch the nucleotide or protein sequences over the network given a taxon or sequence
accession ID - see **Retrieving sequences** below)
- A CLI capable of JSON I/O, batch processing and streaming of inputs for ease of use and pipelining in shell scripts
- A stable, [well-documented](https://taxoniq.github.io/taxoniq/#module-taxoniq), type-hinted Python API
(Python 3.6 and higher is supported)
- Comprehensive testing and continuous integration
- An intuitive interface with useful defaults
- Compactness, readability, and extensibility
The Taxoniq package bundles an indexed, compressed copy of the
[NCBI taxonomy database files](https://ncbiinsights.ncbi.nlm.nih.gov/2018/02/22/new-taxonomy-files-available-with-lineage-type-and-host-information/),
the [NCBI RefSeq](https://www.ncbi.nlm.nih.gov/refseq/) nucleotide and protein sequence accession IDs associated with
each taxon, the [WoL](https://biocore.github.io/wol/) kingdom-wide phylogenomic distance database, and relevant
information from other databases. Sequence accession IDs which appear in the NCBI RefSeq BLAST databases are indexed so
that given a taxon ID, accession ID, or taxon name, you can quickly retrieve the taxon's rank, lineage, description,
citations, representative RefSeq IDs, LCA information, evolutionary distance, sequence (with a network call), and more,
as described in the **Cookbook** section below. Full [API documentation](https://taxoniq.github.io/taxoniq/#module-taxoniq)
is available.
## Installation
pip3 install taxoniq
Pre-built wheels are available for Python 3.5+ on Linux and MacOS. On MacOS 11 Big Sur, Pip 20.3+ is required to install
pre-built wheels (you can check your version with `pip3 --version` and upgrade with `pip3 install --upgrade pip`).
## Synopsis
```python
>>> import taxoniq
>>> t = taxoniq.Taxon(9606)
>>> t.scientific_name
'Homo sapiens'
>>> t.common_name
'human'
>>> t.ranked_lineage
[taxoniq.Taxon(9606), taxoniq.Taxon(9605), taxoniq.Taxon(9604), taxoniq.Taxon(9443),
taxoniq.Taxon(40674), taxoniq.Taxon(7711), taxoniq.Taxon(33208), taxoniq.Taxon(2759)]
>>> len(t.lineage)
32
>>> [(t.rank.name, t.scientific_name) for t in t.ranked_lineage]
[('species', 'Homo sapiens'), ('genus', 'Homo'), ('family', 'Hominidae'), ('order', 'Primates'),
('class', 'Mammalia'), ('phylum', 'Chordata'), ('kingdom', 'Metazoa'), ('superkingdom', 'Eukaryota')]
>>> [(c.rank.name, c.common_name) for c in t.child_nodes]
[('subspecies', 'Neandertal'), ('subspecies', 'Denisova hominin')]
>>> t.refseq_representative_genome_accessions[:10]
[taxoniq.Accession('NC_000001.11'), taxoniq.Accession('NC_000002.12'), taxoniq.Accession('NC_000003.12'),
taxoniq.Accession('NC_000004.12'), taxoniq.Accession('NC_000005.10'), taxoniq.Accession('NC_000006.12'),
taxoniq.Accession('NC_000007.14'), taxoniq.Accession('NC_000008.11'), taxoniq.Accession('NC_000009.12'),
taxoniq.Accession('NC_000010.11')]
>>> t.url
'https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606'
# Wikidata provides structured links to many databases about taxa represented on Wikipedia
>>> t.wikidata_url
'https://www.wikidata.org/wiki/Q15978631'
```
```
>>> t2 = taxoniq.Taxon(scientific_name="Bacillus anthracis")
>>> t2.description
'<p class="mw-empty-elt"> </p> <p><i><b>Bacillus anthracis</b></i> is a Gram-positive and
rod-shaped bacterium that causes anthrax, a deadly disease to livestock and, occasionally, to
humans. It is the only permanent (obligate) pathogen within the genus <i>Bacillus</i>. Its
infection is a type of zoonosis, as it is transmitted from animals to humans. It was discovered
by a German physician Robert Koch in 1876, and became the first bacterium to be experimentally
shown as a pathogen. The discovery was also the first scientific evidence for the germ theory
of diseases.</p><p><i>B. anthracis</i> measures about 3 to 5 μm long and 1 to 1.2 μm wide, and
has a genome of 5,227,293 bp in a single circular DNA. It has two extrachromosal DNA plasmids,
pXO1 and pXO2, which are responsible for the pathogenicity. It forms a protective layer called
endospore by which it can remain inactive for many years and suddenly becomes infective under
suitable environmental conditions. Because of the resilience of the endospore, the bacterium is
one of the most popular biological weapons. The protein capsule (poly-D-gamma-glutamic acid) is
key to evasion of the immune response. It feeds on the heme of blood protein</p>...'
```
```python
>>> t3 = taxoniq.Taxon(accession_id="NC_000913.3")
>>> t3.scientific_name
'Escherichia coli str. K-12 substr. MG1655"'
>>> t3.parent.parent.common_name
'E. coli'
>>> t3.refseq_representative_genome_accessions[0].length
4641652
# The get_from_s3() method is the only command that will trigger a network call.
>>> seq = t3.refseq_representative_genome_accessions[0].get_from_s3().read()
>>> len(seq)
4641652
>>> seq[:64]
b'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT'
```
## Retrieving sequences
Mirrors of the NCBI BLAST databases are maintained on [AWS S3](https://registry.opendata.aws/ncbi-blast-databases/)
(`s3://ncbi-blast-databases`) and Google Storage (`gs://blast-db`). This is a key resource, since S3 and GS have
superior bandwidth and throughput compared to the NCBI FTP server, so range requests can be used to retrieve individual
sequences from the database files without downloading and keeping a copy of the whole database.
The Taxoniq PyPI distribution (the package you install using `pip3 install taxoniq`) indexes sequence accession IDs for
the following NCBI BLAST databases:
- Refseq viruses representative genomes (`ref_viruses_rep_genomes`) (nucleotide)
- Refseq prokaryote representative genomes (contains refseq assembly) (`ref_prok_rep_genomes`) (nucleotide)
- RefSeq Eukaryotic Representative Genome Database (`ref_euk_rep_genomes`) (nucleotide)
- Betacoronavirus (nucleotide)
Given an accession ID, Taxoniq can issue a single HTTP request and return a file-like object streaming the nucleotide
sequence from the S3 or GS mirror as follows:
```python
with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
fh.read()
```
For brevity, you can use [urllib3.response.HTTPResponse.stream](https://urllib3.readthedocs.io/en/latest/advanced-usage.html)
instead of `read(...)` to avoid holding the entire sequence in memory:
```python
with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
for chunk in fh.stream():
sys.stdout.buffer.write(chunk)
```
To retrieve many sequences quickly, you may want to use a threadpool to open multiple network connections at once:
```python
from concurrent.futures import ThreadPoolExecutor
def fetch_seq(accession):
seq = accession.get_from_s3().read()
return (accession, seq)
taxon = taxoniq.Taxon(scientific_name="Apis mellifera")
for accession, seq in ThreadPoolExecutor().map(fetch_seq, taxon.refseq_representative_genome_accessions):
print(accession, len(seq))
```
This operation is also available in the CLI, as described below.
## Command-line interface
`pip3 install taxoniq` installs a command-line utility, `taxoniq`, which can be used to perform many of the same
functions provided by the Python API:
```
>taxoniq child-nodes --taxon-id 2 --output-format '{tax_id}: {scientific_name}'
[
"1224: Proteobacteria",
"2323: Bacteria incertae sedis",
"32066: Fusobacteria",
"40117: Nitrospirae",
"48479: environmental samples",
"49928: unclassified Bacteria",
"57723: Acidobacteria",
"68297: Dictyoglomi",
"74152: Elusimicrobia",
"200783: Aquificae",
"200918: Thermotogae",
"200930: Deferribacteres",
"200938: Chrysiogenetes",
"200940: Thermodesulfobacteria",
"203691: Spirochaetes",
"508458: Synergistetes",
"1783257: PVC group",
"1783270: FCB group",
"1783272: Terrabacteria group",
"1802340: Nitrospinae/Tectomicrobia group",
"1930617: Calditrichaeota",
"2138240: Coprothermobacterota",
"2498710: Caldiserica/Cryosericota group",
"2698788: Candidatus Krumholzibacteriota",
"2716431: Coleospermum",
"2780997: Vogosella"
]
```
See `taxoniq --help` for full details.
#### Retrieving sequences using the CLI
To retrieve an individual sequence in FASTA format given an accession ID, use `taxoniq get-from-s3 --accession-id ACCESSION_ID`.
To retrieve multiple sequences in FASTA format, use `--accession-id -` and pass the IDs on standard input, one per line:
`taxoniq refseq-representative-genome-accessions --scientific-name="Apis mellifera" | jq -r .[] | taxoniq get-from-s3 --accession-id -`.
## Using the core\_nt database
Because of their size, taxoniq wheels with indexes of the
[BLAST Core Nucleotide Database (core\_nt)](https://ncbiinsights.ncbi.nlm.nih.gov/2024/07/18/new-blast-core-nucleotide-database/)
are distributed on GitHub instead of PyPI. After running `pip3 install taxoniq`, you can install the NT indexes as
follows:
- Navigate to https://github.com/taxoniq/taxoniq/releases/latest
- In the "Assets" section, for each link that starts with "ncbi_genbank" and ends with ".whl":
- Right-click on the asset link, and click "Copy link address"
- Run `pip3 install --upgrade <PASTED LINK ADDRESS>`
The core_nt index packages also contain indexes for the RefSeq representative genomes and Betacoronavirus accessions
(meaning they are are superset of the PyPI packages).
## Streaming CLI I/O
The `taxoniq` command-line interface can take streaming input from stdin and produce streaming output on stdout. This
allows the amortization of startup and index load time and efficient operation as part of shell pipelines.
The following
example shows the pipelined operation of [fastp](https://github.com/OpenGene/fastp),
[kraken2](https://github.com/DerrickWood/kraken2/wiki), and taxoniq to annotate hits found in a Betacoronavirus sample:
```
in progress
```
<!--
fastp --thread $KRAKEN2_NUM_THREADS --low_complexity_filter -i R1.fastq.gz -I R2.fastq.gz -o filtered.R1.fastq.gz -O filtered.R2.fastq.gz
kraken2 --paired nohuman_1.fastq nohuman_2.fastq --classified-out 'classified#.fastq' | taxoniq
-->
## Cookbook
In progress
## Links
* [Project home page (GitHub)](https://github.com/taxoniq/taxoniq)
* [Documentation](https://taxoniq.github.io/taxoniq/)
* [Package distribution (PyPI)](https://pypi.python.org/pypi/taxoniq)
* [Change log](https://github.com/taxoniq/taxoniq/blob/master/Changes.rst)
* [ETE Toolkit](http://etetoolkit.org/) and the [ETE Tutorial](http://etetoolkit.org/docs/latest/tutorial/index.html) - a general purpose
phylogenetic tree toolkit with a rich Python interface
## License
Taxoniq software is licensed under the terms of the [MIT License](LICENSE).
Distributions of this package contain data from
[NCBI Taxonomy, NCBI GenBank, and NCBI RefSeq](https://www.ncbi.nlm.nih.gov/) (Bethesda (MD): National Library of
Medicine (US), National Center for Biotechnology Information). These data are released into the public domain under the
[NCBI Public Domain Notice](LICENSE.NCBI).
Distributions of this package contain text excerpts from Wikipedia licensed under the terms of the
[CC-BY-SA License](LICENSE.WIKIPEDIA).
## Bugs
Please report bugs, issues, feature requests, etc. on [GitHub](https://github.com/taxoniq/taxoniq/issues).
Raw data
{
"_id": null,
"home_page": "https://github.com/chanzuckerberg/taxoniq",
"name": "taxoniq",
"maintainer": null,
"docs_url": null,
"requires_python": null,
"maintainer_email": null,
"keywords": null,
"author": "Andrey Kislyuk",
"author_email": "akislyuk@chanzuckerberg.com",
"download_url": "https://files.pythonhosted.org/packages/8a/40/94a7e5dad582aefe8acd7b4b8e1d71119e1719a626dd59d15a70690c4858/taxoniq-1.0.3.tar.gz",
"platform": "MacOS X",
"description": "Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data\n===========================================================================================\n\nTaxoniq is a Python and command-line interface to the\n[NCBI Taxonomy database](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408187/) and selected data sources that\ncross-reference it.\n\nTaxoniq's features include:\n\n- Pre-computed indexes updated monthly from NCBI, [WoL](https://biocore.github.io/wol/) and cross-referenced databases\n- Offline operation: all indexes are bundled with the package; no network calls are made when querying taxon information\n (separately, Taxoniq can fetch the nucleotide or protein sequences over the network given a taxon or sequence\n accession ID - see **Retrieving sequences** below)\n- A CLI capable of JSON I/O, batch processing and streaming of inputs for ease of use and pipelining in shell scripts\n- A stable, [well-documented](https://taxoniq.github.io/taxoniq/#module-taxoniq), type-hinted Python API\n (Python 3.6 and higher is supported)\n- Comprehensive testing and continuous integration\n- An intuitive interface with useful defaults\n- Compactness, readability, and extensibility\n\nThe Taxoniq package bundles an indexed, compressed copy of the\n[NCBI taxonomy database files](https://ncbiinsights.ncbi.nlm.nih.gov/2018/02/22/new-taxonomy-files-available-with-lineage-type-and-host-information/),\nthe [NCBI RefSeq](https://www.ncbi.nlm.nih.gov/refseq/) nucleotide and protein sequence accession IDs associated with\neach taxon, the [WoL](https://biocore.github.io/wol/) kingdom-wide phylogenomic distance database, and relevant\ninformation from other databases. Sequence accession IDs which appear in the NCBI RefSeq BLAST databases are indexed so\nthat given a taxon ID, accession ID, or taxon name, you can quickly retrieve the taxon's rank, lineage, description,\ncitations, representative RefSeq IDs, LCA information, evolutionary distance, sequence (with a network call), and more,\nas described in the **Cookbook** section below. Full [API documentation](https://taxoniq.github.io/taxoniq/#module-taxoniq)\nis available.\n\n## Installation\n\n pip3 install taxoniq\n\nPre-built wheels are available for Python 3.5+ on Linux and MacOS. On MacOS 11 Big Sur, Pip 20.3+ is required to install\npre-built wheels (you can check your version with `pip3 --version` and upgrade with `pip3 install --upgrade pip`).\n\n## Synopsis\n\n```python\n>>> import taxoniq\n>>> t = taxoniq.Taxon(9606)\n>>> t.scientific_name\n'Homo sapiens'\n>>> t.common_name\n'human'\n\n>>> t.ranked_lineage\n[taxoniq.Taxon(9606), taxoniq.Taxon(9605), taxoniq.Taxon(9604), taxoniq.Taxon(9443),\n taxoniq.Taxon(40674), taxoniq.Taxon(7711), taxoniq.Taxon(33208), taxoniq.Taxon(2759)]\n>>> len(t.lineage)\n32\n>>> [(t.rank.name, t.scientific_name) for t in t.ranked_lineage]\n[('species', 'Homo sapiens'), ('genus', 'Homo'), ('family', 'Hominidae'), ('order', 'Primates'),\n ('class', 'Mammalia'), ('phylum', 'Chordata'), ('kingdom', 'Metazoa'), ('superkingdom', 'Eukaryota')]\n>>> [(c.rank.name, c.common_name) for c in t.child_nodes]\n[('subspecies', 'Neandertal'), ('subspecies', 'Denisova hominin')]\n\n>>> t.refseq_representative_genome_accessions[:10]\n[taxoniq.Accession('NC_000001.11'), taxoniq.Accession('NC_000002.12'), taxoniq.Accession('NC_000003.12'),\n taxoniq.Accession('NC_000004.12'), taxoniq.Accession('NC_000005.10'), taxoniq.Accession('NC_000006.12'),\n taxoniq.Accession('NC_000007.14'), taxoniq.Accession('NC_000008.11'), taxoniq.Accession('NC_000009.12'),\n taxoniq.Accession('NC_000010.11')]\n\n>>> t.url\n'https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606'\n\n# Wikidata provides structured links to many databases about taxa represented on Wikipedia\n>>> t.wikidata_url\n'https://www.wikidata.org/wiki/Q15978631'\n```\n\n```\n>>> t2 = taxoniq.Taxon(scientific_name=\"Bacillus anthracis\")\n>>> t2.description\n'<p class=\"mw-empty-elt\"> </p> <p><i><b>Bacillus anthracis</b></i> is a Gram-positive and\n rod-shaped bacterium that causes anthrax, a deadly disease to livestock and, occasionally, to\n humans. It is the only permanent (obligate) pathogen within the genus <i>Bacillus</i>. Its\n infection is a type of zoonosis, as it is transmitted from animals to humans. It was discovered\n by a German physician Robert Koch in 1876, and became the first bacterium to be experimentally\n shown as a pathogen. The discovery was also the first scientific evidence for the germ theory\n of diseases.</p><p><i>B. anthracis</i> measures about 3 to 5 \u03bcm long and 1 to 1.2 \u03bcm wide, and\n has a genome of 5,227,293 bp in a single circular DNA. It has two extrachromosal DNA plasmids,\n pXO1 and pXO2, which are responsible for the pathogenicity. It forms a protective layer called\n endospore by which it can remain inactive for many years and suddenly becomes infective under\n suitable environmental conditions. Because of the resilience of the endospore, the bacterium is\n one of the most popular biological weapons. The protein capsule (poly-D-gamma-glutamic acid) is\n key to evasion of the immune response. It feeds on the heme of blood protein</p>...'\n```\n\n```python\n>>> t3 = taxoniq.Taxon(accession_id=\"NC_000913.3\")\n>>> t3.scientific_name\n'Escherichia coli str. K-12 substr. MG1655\"'\n>>> t3.parent.parent.common_name\n'E. coli'\n>>> t3.refseq_representative_genome_accessions[0].length\n4641652\n\n# The get_from_s3() method is the only command that will trigger a network call.\n>>> seq = t3.refseq_representative_genome_accessions[0].get_from_s3().read()\n>>> len(seq)\n4641652\n>>> seq[:64]\nb'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT'\n```\n\n## Retrieving sequences\n\nMirrors of the NCBI BLAST databases are maintained on [AWS S3](https://registry.opendata.aws/ncbi-blast-databases/)\n(`s3://ncbi-blast-databases`) and Google Storage (`gs://blast-db`). This is a key resource, since S3 and GS have\nsuperior bandwidth and throughput compared to the NCBI FTP server, so range requests can be used to retrieve individual\nsequences from the database files without downloading and keeping a copy of the whole database.\n\nThe Taxoniq PyPI distribution (the package you install using `pip3 install taxoniq`) indexes sequence accession IDs for\nthe following NCBI BLAST databases:\n\n- Refseq viruses representative genomes (`ref_viruses_rep_genomes`) (nucleotide)\n- Refseq prokaryote representative genomes (contains refseq assembly) (`ref_prok_rep_genomes`) (nucleotide)\n- RefSeq Eukaryotic Representative Genome Database (`ref_euk_rep_genomes`) (nucleotide)\n- Betacoronavirus (nucleotide)\n\nGiven an accession ID, Taxoniq can issue a single HTTP request and return a file-like object streaming the nucleotide\nsequence from the S3 or GS mirror as follows:\n```python\nwith taxoniq.Accession(\"NC_000913.3\").get_from_s3() as fh:\n fh.read()\n```\nFor brevity, you can use [urllib3.response.HTTPResponse.stream](https://urllib3.readthedocs.io/en/latest/advanced-usage.html)\ninstead of `read(...)` to avoid holding the entire sequence in memory:\n```python\nwith taxoniq.Accession(\"NC_000913.3\").get_from_s3() as fh:\n for chunk in fh.stream():\n sys.stdout.buffer.write(chunk)\n```\n\nTo retrieve many sequences quickly, you may want to use a threadpool to open multiple network connections at once:\n```python\nfrom concurrent.futures import ThreadPoolExecutor\ndef fetch_seq(accession):\n seq = accession.get_from_s3().read()\n return (accession, seq)\n\ntaxon = taxoniq.Taxon(scientific_name=\"Apis mellifera\")\nfor accession, seq in ThreadPoolExecutor().map(fetch_seq, taxon.refseq_representative_genome_accessions):\n print(accession, len(seq))\n```\nThis operation is also available in the CLI, as described below.\n\n## Command-line interface\n`pip3 install taxoniq` installs a command-line utility, `taxoniq`, which can be used to perform many of the same\nfunctions provided by the Python API:\n```\n>taxoniq child-nodes --taxon-id 2 --output-format '{tax_id}: {scientific_name}'\n[\n \"1224: Proteobacteria\",\n \"2323: Bacteria incertae sedis\",\n \"32066: Fusobacteria\",\n \"40117: Nitrospirae\",\n \"48479: environmental samples\",\n \"49928: unclassified Bacteria\",\n \"57723: Acidobacteria\",\n \"68297: Dictyoglomi\",\n \"74152: Elusimicrobia\",\n \"200783: Aquificae\",\n \"200918: Thermotogae\",\n \"200930: Deferribacteres\",\n \"200938: Chrysiogenetes\",\n \"200940: Thermodesulfobacteria\",\n \"203691: Spirochaetes\",\n \"508458: Synergistetes\",\n \"1783257: PVC group\",\n \"1783270: FCB group\",\n \"1783272: Terrabacteria group\",\n \"1802340: Nitrospinae/Tectomicrobia group\",\n \"1930617: Calditrichaeota\",\n \"2138240: Coprothermobacterota\",\n \"2498710: Caldiserica/Cryosericota group\",\n \"2698788: Candidatus Krumholzibacteriota\",\n \"2716431: Coleospermum\",\n \"2780997: Vogosella\"\n]\n```\nSee `taxoniq --help` for full details.\n#### Retrieving sequences using the CLI\nTo retrieve an individual sequence in FASTA format given an accession ID, use `taxoniq get-from-s3 --accession-id ACCESSION_ID`.\n\nTo retrieve multiple sequences in FASTA format, use `--accession-id -` and pass the IDs on standard input, one per line:\n`taxoniq refseq-representative-genome-accessions --scientific-name=\"Apis mellifera\" | jq -r .[] | taxoniq get-from-s3 --accession-id -`.\n\n## Using the core\\_nt database\nBecause of their size, taxoniq wheels with indexes of the\n[BLAST Core Nucleotide Database (core\\_nt)](https://ncbiinsights.ncbi.nlm.nih.gov/2024/07/18/new-blast-core-nucleotide-database/)\nare distributed on GitHub instead of PyPI. After running `pip3 install taxoniq`, you can install the NT indexes as\nfollows:\n\n- Navigate to https://github.com/taxoniq/taxoniq/releases/latest\n- In the \"Assets\" section, for each link that starts with \"ncbi_genbank\" and ends with \".whl\":\n - Right-click on the asset link, and click \"Copy link address\"\n - Run `pip3 install --upgrade <PASTED LINK ADDRESS>`\n\nThe core_nt index packages also contain indexes for the RefSeq representative genomes and Betacoronavirus accessions\n(meaning they are are superset of the PyPI packages).\n\n## Streaming CLI I/O\nThe `taxoniq` command-line interface can take streaming input from stdin and produce streaming output on stdout. This\nallows the amortization of startup and index load time and efficient operation as part of shell pipelines.\n\nThe following\nexample shows the pipelined operation of [fastp](https://github.com/OpenGene/fastp),\n[kraken2](https://github.com/DerrickWood/kraken2/wiki), and taxoniq to annotate hits found in a Betacoronavirus sample:\n```\nin progress\n```\n<!--\nfastp --thread $KRAKEN2_NUM_THREADS --low_complexity_filter -i R1.fastq.gz -I R2.fastq.gz -o filtered.R1.fastq.gz -O filtered.R2.fastq.gz\n\nkraken2 --paired nohuman_1.fastq nohuman_2.fastq --classified-out 'classified#.fastq' | taxoniq\n-->\n\n## Cookbook\nIn progress\n\n## Links\n* [Project home page (GitHub)](https://github.com/taxoniq/taxoniq)\n* [Documentation](https://taxoniq.github.io/taxoniq/)\n* [Package distribution (PyPI)](https://pypi.python.org/pypi/taxoniq)\n* [Change log](https://github.com/taxoniq/taxoniq/blob/master/Changes.rst)\n* [ETE Toolkit](http://etetoolkit.org/) and the [ETE Tutorial](http://etetoolkit.org/docs/latest/tutorial/index.html) - a general purpose\n phylogenetic tree toolkit with a rich Python interface\n\n## License\nTaxoniq software is licensed under the terms of the [MIT License](LICENSE).\n\nDistributions of this package contain data from\n[NCBI Taxonomy, NCBI GenBank, and NCBI RefSeq](https://www.ncbi.nlm.nih.gov/) (Bethesda (MD): National Library of\nMedicine (US), National Center for Biotechnology Information). These data are released into the public domain under the\n[NCBI Public Domain Notice](LICENSE.NCBI).\n\nDistributions of this package contain text excerpts from Wikipedia licensed under the terms of the\n[CC-BY-SA License](LICENSE.WIKIPEDIA).\n\n## Bugs\nPlease report bugs, issues, feature requests, etc. on [GitHub](https://github.com/taxoniq/taxoniq/issues).\n",
"bugtrack_url": null,
"license": "MIT License",
"summary": "Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data",
"version": "1.0.3",
"project_urls": {
"Documentation": "https://chanzuckerberg.github.io/taxoniq",
"Homepage": "https://github.com/chanzuckerberg/taxoniq",
"Issue Tracker": "https://github.com/chanzuckerberg/taxoniq/issues",
"Source Code": "https://github.com/chanzuckerberg/taxoniq"
},
"split_keywords": [],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "8a4094a7e5dad582aefe8acd7b4b8e1d71119e1719a626dd59d15a70690c4858",
"md5": "488007096b8fd76160b50f4e9573a1d8",
"sha256": "538ae19d56b72707b2caf3e9948ad4946597c6677e76e36d3b77638ad9e3709b"
},
"downloads": -1,
"filename": "taxoniq-1.0.3.tar.gz",
"has_sig": false,
"md5_digest": "488007096b8fd76160b50f4e9573a1d8",
"packagetype": "sdist",
"python_version": "source",
"requires_python": null,
"size": 61445,
"upload_time": "2024-09-18T15:58:32",
"upload_time_iso_8601": "2024-09-18T15:58:32.862839Z",
"url": "https://files.pythonhosted.org/packages/8a/40/94a7e5dad582aefe8acd7b4b8e1d71119e1719a626dd59d15a70690c4858/taxoniq-1.0.3.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2024-09-18 15:58:32",
"github": true,
"gitlab": false,
"bitbucket": false,
"codeberg": false,
"github_user": "chanzuckerberg",
"github_project": "taxoniq",
"travis_ci": false,
"coveralls": false,
"github_actions": true,
"lcname": "taxoniq"
}
JSON
