# cvmmlst
```
__ __
______ ______ ___ ____ ___ / /____/ /_
/ ___/ | / / __ `__ \/ __ `__ \/ / ___/ __/
/ /__ | |/ / / / / / / / / / / / (__ ) /_
\___/ |___/_/ /_/ /_/_/ /_/ /_/_/____/\__/
```
cvmmlst is a bacteria mlst analysis tool that could run on Windows, Linux and MAC os. Some of the code ideas in cvmmlst draw on Torsten Seemanns excellent [mlst](https://github.com/tseemann/mlst) tool.
## 1. Installation
```
pip3 install cvmmlst
```
## 2. Dependency
- BLAST+ >2.7.0
**you should add BLAST in your PATH**
## 3. Blast installation
### 3.1 Windows
Following this tutorial:
[Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)
### 3.2 Linux/Mac
The easyest way to install blast is:
```
conda install -c bioconda blast
```
## 4. Introduction
### 4.1 Initialize reference database
After finish installation, you should first initialize the reference database using following command
```
cvmmlst init
```
### 4.2 Usage
```
usage: cvmmlst -i <genome assemble directory> -o <output_directory>
Author: Qingpo Cui(SZQ Lab, China Agricultural University)
options:
-h, --help show this help message and exit
-i I <input_path>: the PATH to the directory of assembled genome files. Could not use with -f
-f F <input_file>: the PATH of assembled genome file. Could not use with -i
-o O <output_directory>: output PATH
-scheme SCHEME <mlst scheme want to use>, cvmmlst show_schemes command could output all available schems
-minid MINID <minimum threshold of identity>, default=90
-mincov MINCOV <minimum threshold of coverage>, default=60
-t T <number of threads>: default=8
-v, --version Display version
cvmmlst subcommand:
{init,show_schemes,add_scheme}
init <initialize the reference database>
show_schemes <show the list of all available schemes>
add_scheme <add custome scheme, use cvmmlst add_scheme -h for help>
```
### 4.3 Show available schemes
```
cvmmlst show_schemes
```
### 4.4 Add custome scheme
```
usage: cvmmlst -i <genome assemble directory> -o <output_directory>
Author: Qingpo Cui(SZQ Lab, China Agricultural University) add_scheme
[-h] [-name NAME] [-path PATH]
optional arguments:
-h, --help show this help message and exit
-name NAME <the custome scheme name>
-path PATH <the path to the files of custome scheme>
```
-name: str -> the scheme name you want to use with -scheme options
-path: str -> the path of the directory that contains the fasta files of locus in schemes and the profile file
#### Example
```
cvmmlst add_scheme -name my_scheme -path PATH_TO_my_scheme
```
The structure of scheme directory should looks like:
```
own_scheme
├── locus1.fasta
├── locus2.fasta
├── locus3.fasta
├── locus4.fasta
├── locus5.fasta
├── locus6.fasta
├── locus7.fasta
└── own_scheme.txt
```
The fasta file of corresponding locus is a multifasta file.
The multifasta file looks like:
```
>locus1_1
ATGATAGGTGAAGATATACAAAGAGTATTAG
>locus1_2
ATGATAGGTGAAGATATACAAAGAGTATTAG
>locus1_3
ATGATAGGTGAAGATATACAAAGAGTATTAG
>locus1_4
ATGATAGGCGAAGATATACAAAGAGTATTAG
>alocus1_5
ATGATAGGCGAAGATATACAAAGAGTATTAG
>locus1_6
ATGATAGGTGAAGATATACAAAGAGTATTAG
```
The own_scheme.txt is a tab-delimited text file.
The profile looks like:
|ST|locus1|locus2|locus3|locus4|locus5|locus6|locus7|clonal_complex|
|---|---|---|---|---|---|---|---|---|
|1|2|1|54|3|4|1|5|ST-21 complex|
|2|4|7|51|4|1|7|1|ST-45 complex|
|3|3|2|5|10|11|11|6|ST-49 complex|
|4|10|11|16|7|10|5|7|ST-403 complex|
|5|7|2|5|2|10|3|6|ST-353 complex|
|6|63|34|27|33|45|5|7||
|7|8|10|2|2|14|12|6|ST-354 complex|
### 4.5 Output
you will get a text file and a summray file in csv format in the output directory.
The text file like
|dat | bglA | cat |ldh |abcZ | dapE | lhkA | ST | Scheme | FILE|
|---|---|---|---|---|---|---|---|---|---|
|3 |1 |4| 39 | 12 | 14 | 4 |87 | listeria_2 | 665|
The content in csv summary file like
|dat | bglA | cat |ldh |abcZ | dapE | lhkA | ST | Scheme | FILE|
|---|---|---|---|---|---|---|---|---|---|
|3 |1 |4| 39 | 12 | 14 | 4 |87 | listeria_2 | sample01|
|2 |4 |4 |1 |4 |3 |5 |3 |listeria_2 | sample02|
|6 |6| 8 |37 | 7 |8 |1 |121| listeria_2 | sample03|
|3 |1 |4| 39 | 12 | 14 | 4 |87 | listeria_2 | sample04|
|2 |4 |4 |1 |4 |3 |5 |3 |listeria_2 | sample05|
|6 |6| 8 |37 | 7 |8 |1 |121| listeria_2 | sample06|
## 5. Update logs
|Date|Content|
|---|---|
|2024-08-12|Add three subcommand (init, show_schems, add_scheme)|
Raw data
{
"_id": null,
"home_page": "https://github.com/hbucqp/cvmmlst",
"name": "cvmmlst",
"maintainer": null,
"docs_url": null,
"requires_python": null,
"maintainer_email": null,
"keywords": "wgs, pubmlst, mlst",
"author": "Qingpo Cui",
"author_email": "cqp@cau.edu.cn",
"download_url": "https://files.pythonhosted.org/packages/ca/cb/7c7b28d7b93dc227a5fe709767540b829e7df216110cee8675a3afe5377a/cvmmlst-0.3.5.tar.gz",
"platform": "any",
"description": "# cvmmlst\n\n\n```\n __ __\n ______ ______ ___ ____ ___ / /____/ /_\n / ___/ | / / __ `__ \\/ __ `__ \\/ / ___/ __/\n/ /__ | |/ / / / / / / / / / / / (__ ) /_\n\\___/ |___/_/ /_/ /_/_/ /_/ /_/_/____/\\__/\n\n\n```\n\ncvmmlst is a bacteria mlst analysis tool that could run on Windows, Linux and MAC os. Some of the code ideas in cvmmlst draw on Torsten Seemanns excellent [mlst](https://github.com/tseemann/mlst) tool.\n\n\n\n\n\n\n## 1. Installation\n```\npip3 install cvmmlst\n```\n\n\n\n\n## 2. Dependency\n- BLAST+ >2.7.0\n\n**you should add BLAST in your PATH**\n\n\n## 3. Blast installation\n### 3.1 Windows\n\n\nFollowing this tutorial:\n[Add blast into your windows PATH](http://82.157.185.121:22300/shares/BevQrP0j8EXn76p7CwfheA)\n\n### 3.2 Linux/Mac\nThe easyest way to install blast is:\n\n```\nconda install -c bioconda blast\n```\n\n\n\n## 4. Introduction\n\n### 4.1 Initialize reference database\n\nAfter finish installation, you should first initialize the reference database using following command\n```\ncvmmlst init\n```\n\n\n### 4.2 Usage\n```\nusage: cvmmlst -i <genome assemble directory> -o <output_directory>\n\nAuthor: Qingpo Cui(SZQ Lab, China Agricultural University)\n\noptions:\n -h, --help show this help message and exit\n -i I <input_path>: the PATH to the directory of assembled genome files. Could not use with -f\n -f F <input_file>: the PATH of assembled genome file. Could not use with -i\n -o O <output_directory>: output PATH\n -scheme SCHEME <mlst scheme want to use>, cvmmlst show_schemes command could output all available schems\n -minid MINID <minimum threshold of identity>, default=90\n -mincov MINCOV <minimum threshold of coverage>, default=60\n -t T <number of threads>: default=8\n -v, --version Display version\n\ncvmmlst subcommand:\n {init,show_schemes,add_scheme}\n init <initialize the reference database>\n show_schemes <show the list of all available schemes>\n add_scheme <add custome scheme, use cvmmlst add_scheme -h for help>\n```\n\n### 4.3 Show available schemes\n\n```\ncvmmlst show_schemes\n```\n\n\n\n### 4.4 Add custome scheme\n```\nusage: cvmmlst -i <genome assemble directory> -o <output_directory>\n\nAuthor: Qingpo Cui(SZQ Lab, China Agricultural University) add_scheme\n [-h] [-name NAME] [-path PATH]\n\noptional arguments:\n -h, --help show this help message and exit\n -name NAME <the custome scheme name>\n -path PATH <the path to the files of custome scheme>\n```\n\n-name: str -> the scheme name you want to use with -scheme options\n\n-path: str -> the path of the directory that contains the fasta files of locus in schemes and the profile file\n\n#### Example\n```\ncvmmlst add_scheme -name my_scheme -path PATH_TO_my_scheme\n```\n\nThe structure of scheme directory should looks like:\n```\nown_scheme\n\u251c\u2500\u2500 locus1.fasta\n\u251c\u2500\u2500 locus2.fasta\n\u251c\u2500\u2500 locus3.fasta\n\u251c\u2500\u2500 locus4.fasta\n\u251c\u2500\u2500 locus5.fasta\n\u251c\u2500\u2500 locus6.fasta\n\u251c\u2500\u2500 locus7.fasta\n\u2514\u2500\u2500 own_scheme.txt\n```\n\nThe fasta file of corresponding locus is a multifasta file.\n\nThe multifasta file looks like:\n```\n>locus1_1\nATGATAGGTGAAGATATACAAAGAGTATTAG\n>locus1_2\nATGATAGGTGAAGATATACAAAGAGTATTAG\n>locus1_3\nATGATAGGTGAAGATATACAAAGAGTATTAG\n>locus1_4\nATGATAGGCGAAGATATACAAAGAGTATTAG\n>alocus1_5\nATGATAGGCGAAGATATACAAAGAGTATTAG\n>locus1_6\nATGATAGGTGAAGATATACAAAGAGTATTAG\n```\n\nThe own_scheme.txt is a tab-delimited text file.\n\nThe profile looks like:\n\n\n|ST|locus1|locus2|locus3|locus4|locus5|locus6|locus7|clonal_complex|\n|---|---|---|---|---|---|---|---|---|\n|1|2|1|54|3|4|1|5|ST-21 complex|\n|2|4|7|51|4|1|7|1|ST-45 complex|\n|3|3|2|5|10|11|11|6|ST-49 complex|\n|4|10|11|16|7|10|5|7|ST-403 complex|\n|5|7|2|5|2|10|3|6|ST-353 complex|\n|6|63|34|27|33|45|5|7||\n|7|8|10|2|2|14|12|6|ST-354 complex|\n\n\n### 4.5 Output\n\nyou will get a text file and a summray file in csv format in the output directory.\n\nThe text file like\n|dat | bglA | cat |ldh |abcZ | dapE | lhkA | ST | Scheme | FILE|\n|---|---|---|---|---|---|---|---|---|---|\n|3 |1 |4| 39 | 12 | 14 | 4 |87 | listeria_2 | 665|\n\nThe content in csv summary file like\n|dat | bglA | cat |ldh |abcZ | dapE | lhkA | ST | Scheme | FILE|\n|---|---|---|---|---|---|---|---|---|---|\n|3 |1 |4| 39 | 12 | 14 | 4 |87 | listeria_2 | sample01|\n|2 |4 |4 |1 |4 |3 |5 |3 |listeria_2 | sample02|\n|6 |6| 8 |37 | 7 |8 |1 |121| listeria_2 | sample03|\n|3 |1 |4| 39 | 12 | 14 | 4 |87 | listeria_2 | sample04|\n|2 |4 |4 |1 |4 |3 |5 |3 |listeria_2 | sample05|\n|6 |6| 8 |37 | 7 |8 |1 |121| listeria_2 | sample06|\n\n\n\n\n## 5. Update logs\n|Date|Content|\n|---|---|\n|2024-08-12|Add three subcommand (init, show_schems, add_scheme)|\n\n\n",
"bugtrack_url": null,
"license": "MIT Licence",
"summary": "python mlst analysis tool",
"version": "0.3.5",
"project_urls": {
"Homepage": "https://github.com/hbucqp/cvmmlst"
},
"split_keywords": [
"wgs",
" pubmlst",
" mlst"
],
"urls": [
{
"comment_text": "",
"digests": {
"blake2b_256": "7efec96d9eb0861eb66b25cdec21d1c6574c747464fec81a0ef43c21d25740c7",
"md5": "1c008bd0a5656714ec7cbfc645b2c900",
"sha256": "22a3ba6f1a3642c743a518dc600d6a790dcf9c2dd78f5315fa1fef26510675b8"
},
"downloads": -1,
"filename": "cvmmlst-0.3.5-py3-none-any.whl",
"has_sig": false,
"md5_digest": "1c008bd0a5656714ec7cbfc645b2c900",
"packagetype": "bdist_wheel",
"python_version": "py3",
"requires_python": null,
"size": 20069545,
"upload_time": "2024-08-19T12:08:56",
"upload_time_iso_8601": "2024-08-19T12:08:56.437428Z",
"url": "https://files.pythonhosted.org/packages/7e/fe/c96d9eb0861eb66b25cdec21d1c6574c747464fec81a0ef43c21d25740c7/cvmmlst-0.3.5-py3-none-any.whl",
"yanked": false,
"yanked_reason": null
},
{
"comment_text": "",
"digests": {
"blake2b_256": "cacb7c7b28d7b93dc227a5fe709767540b829e7df216110cee8675a3afe5377a",
"md5": "a789817cd48a3c4ffc3075f1a929cad2",
"sha256": "05face12fa135a86589f176a687452f572fe076355598873988ab9bb97c2d7b7"
},
"downloads": -1,
"filename": "cvmmlst-0.3.5.tar.gz",
"has_sig": false,
"md5_digest": "a789817cd48a3c4ffc3075f1a929cad2",
"packagetype": "sdist",
"python_version": "source",
"requires_python": null,
"size": 18014645,
"upload_time": "2024-08-19T12:09:10",
"upload_time_iso_8601": "2024-08-19T12:09:10.574808Z",
"url": "https://files.pythonhosted.org/packages/ca/cb/7c7b28d7b93dc227a5fe709767540b829e7df216110cee8675a3afe5377a/cvmmlst-0.3.5.tar.gz",
"yanked": false,
"yanked_reason": null
}
],
"upload_time": "2024-08-19 12:09:10",
"github": true,
"gitlab": false,
"bitbucket": false,
"codeberg": false,
"github_user": "hbucqp",
"github_project": "cvmmlst",
"travis_ci": false,
"coveralls": false,
"github_actions": false,
"requirements": [],
"lcname": "cvmmlst"
}
JSON
