sadie-antibody


Namesadie-antibody JSON
Version 1.0.6 PyPI version JSON
download
home_pagehttps://sadie.jordanrwillis.com
Summary"The Complete Antibody Library"
upload_time2023-10-06 18:06:23
maintainer
docs_urlNone
authorJordan R. Willis
requires_python>=3.8,<3.12
licenseMIT
keywords antibody bioinformatics biology computational biology protein immunoinformatics
VCS
bugtrack_url
requirements No requirements were recorded.
Travis-CI No Travis.
coveralls test coverage No coveralls.
            <!-- markdownlint-disable -->

<h2 align="center" style="font-family:verdana;font-size:150%"> <b>S</b>equencing <b>A</b>nalysis and <b>D</b>ata Library for <b>I</b>mmunoinformatics <b>E</b>xploration</h2>
<div align="center">
  <img src="https://sadiestaticcrm.s3.us-west-2.amazonaws.com/Sadie.svg" alt="SADIE" style="margin:0.51em;width:50%">
</div>

<div class="flex-container" align="center">
    <div class="flex-container" align="center">
        <a href="https://img.shields.io/badge/Python-3.7%7C3.8%7C3.9%7C3.10-blue">
        <img src="https://img.shields.io/badge/Python-3.7%7C3.8%7C3.9%7C3.10-blue"
            alt="Python Version">
        <a href="https://github.com/psf/black">
        <img src="https://img.shields.io/badge/code%20style-black-000000.svg"
            alt="Format Version">
        <a href="https://codecov.io/gh/jwillis0720/sadie">
        <img src="https://codecov.io/gh/jwillis0720/sadie/branch/main/graph/badge.svg?token=EH9QEX4ZMP"
            alt="Code Coverage">
        <a href="https://github.com/pre-commit/pre-commit">
    </div>
    <div class="flex-container" align="center">
        <img src="https://img.shields.io/badge/pre--commit-enabled-brightgreen?logo=pre-commit&logoColor=white"
            alt="pre commit">
        <a href="https://pypi.org/project/sadie-antibody">
        <img src="https://img.shields.io/pypi/v/sadie-antibody?color=blue"
            alt='pypi'>
        <a href="https://sadie.jordanrwillis.com" >
        <img src="https://api.netlify.com/api/v1/badges/59ff956c-82d9-4900-83c7-758ed21ccb34/deploy-status"
            alt="Documentation">
        </a>
        <a href="https://github.com/jwillis0720/sadie/actions/workflows/docs.yml" >
        <img src="https://github.com/jwillis0720/sadie/actions/workflows/docs.yml/badge.svg"
            alt="Documentation">
        </a>
    </div>
    <div class="flex-container" align="center">
        <a href="https://github.com/jwillis0720/sadie/workflows/Linux%20Build%20and%20Test/badge.svg">
        <img src="https://github.com/jwillis0720/sadie/workflows/Linux%20Build%20and%20Test/badge.svg"
            alt="Linux Build">
        <a href="https://github.com/jwillis0720/sadie/workflows/MacOS%20Build%20and%20Test/badge.svg">
        <img src="https://github.com/jwillis0720/sadie/workflows/MacOS%20Build%20and%20Test/badge.svg"
            alt="Mac Build">
        <a href="https://github.com/jwillis0720/sadie/actions/workflows/pyright.yml/badge.svg">
        <img src="https://github.com/jwillis0720/sadie/actions/workflows/pyright.yml/badge.svg"
            alt="Static Type">
    </div>
</div>
<!-- markdownlint-restore -->

## About

---

<!-- use a href so you can use _blank to open new tab -->

**Documentation**: <a href="https://sadie.jordanrwillis.com" target="_blank">https://sadie.jordanrwillis.com</a>

**Source Code**: <a href="https://github.com/jwillis0720/sadie" target="_blank">https://github.com/jwillis0720/sadie</a>

**Colab**: [https://colab.research.google.com/github/jwillis0720/sadie](https://colab.research.google.com/github/jwillis0720/sadie/blob/main/notebooks/airr_c/SADIE_DEMO.ipynb)

---

SADIE is the **S**equencing **A**nalysis and **D**ata library for **I**mmunoinformatics **E**xploration. The key feautures include:

- Provide pre-built **command line applications** for popular immunoinformatics applications.

- Provide a **low-level API framework** for immunoinformatics developers to build higher level tools.

- Provide a **testable** and **reusable** library that WORKS!

- Provide a **customizable** and **verified** germline reference library.

- Maintain data formats consistent with standards governed by the [**AIRR community**](https://docs.airr-community.org/en/stable/#table-of-contents)

- **Portability** ready to use out the box.

SADIE is billed as a "**complete antibody library**", not because it aims to do everything, but because it aims to meet the needs of all immunoinformatics users. SADIE contains both low, mid and high level functionality for immunoinformatics tools and workflows. You can use SADIE as a framework to develop your own tools, use many of the prebuilt contributed tools, or run it in a notebook to enable data exploration. In addition, SADIE aims to port all code to python because relies heavily on the [Pandas](https://www.pandas.org) library, the workhorse of the data science/machine learning age.

## Installation

---

Installation is handled using the python package installer `pip`

```console
$ pip install sadie-antibody
```

### Development installation.

Pull requests are highly encouraged [here](https://github.com/jwillis0720/sadie/pulls). The development installation uses [pre-commit](https://pre-commit.com/), [flake8](https://flake8.pycqa.org/en/latest/) linting and [black](https://github.com/psf/black) style formatting to maintain code readability and reausability.

```console
$ git clone git@github.com/jwillis0720/sadie.git
$ pip install poetry
$ poetry install --with dev
```

## Quick Usage

Consult the [documentation](https://sadie.jordanrwillis.com) for complete usage. Or checkout our [Colab](https://colab.research.google.com/github/jwillis0720/sadie/blob/main/notebooks/airr_c/SADIE_DEMO.ipynb) notebook

### Command Line Usage

Annotate antibody sequences only from functional human imgt antibodies to a gzip output

```console
$ sadie airr my_sequence.fasta
```

### API

```python
from sadie.airr import Airr
# define a single sequence
pg9_seq = """
    CAGCGATTAGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGTCGTCCCTGAGACTCTCCTGTGCAGCGT
    CCGGATTCGACTTCAGTAGACAAGGCATGCACTGGGTCCGCCAGGCTCCAGGCCAGGGGCTGGAGTGGGT
    GGCATTTATTAAATATGATGGAAGTGAGAAATATCATGCTGACTCCGTATGGGGCCGACTCAGCATCTCC
    AGAGACAATTCCAAGGATACGCTTTATCTCCAAATGAATAGCCTGAGAGTCGAGGACACGGCTACATATT
    TTTGTGTGAGAGAGGCTGGTGGGCCCGACTACCGTAATGGGTACAACTATTACGATTTCTATGATGGTTA
    TTATAACTACCACTATATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCGAGC""".replace(
    "\n", ""
)

# initialize the api
air_api = Airr("human")

# run single sequence string
airr_table = air_api.run_single("PG9", pg9_seq)
```

## License

[![License](https://img.shields.io/github/license/jwillis0720/sadie)](https://opensource.org/licenses/MIT)

- Copyright © Jordan R. Willis, Troy M. Sincomb & Caleb K. Kibet

            

Raw data

            {
    "_id": null,
    "home_page": "https://sadie.jordanrwillis.com",
    "name": "sadie-antibody",
    "maintainer": "",
    "docs_url": null,
    "requires_python": ">=3.8,<3.12",
    "maintainer_email": "",
    "keywords": "antibody,bioinformatics,biology,computational biology,protein,immunoinformatics",
    "author": "Jordan R. Willis",
    "author_email": "jwillis0720@gmail.com",
    "download_url": "https://files.pythonhosted.org/packages/18/ee/4a62f8c9f1a21e1ceef7169a790a5263a1ae8fa909e0958f18f3b58ffa0e/sadie_antibody-1.0.6.tar.gz",
    "platform": null,
    "description": "<!-- markdownlint-disable -->\n\n<h2 align=\"center\" style=\"font-family:verdana;font-size:150%\"> <b>S</b>equencing <b>A</b>nalysis and <b>D</b>ata Library for <b>I</b>mmunoinformatics <b>E</b>xploration</h2>\n<div align=\"center\">\n  <img src=\"https://sadiestaticcrm.s3.us-west-2.amazonaws.com/Sadie.svg\" alt=\"SADIE\" style=\"margin:0.51em;width:50%\">\n</div>\n\n<div class=\"flex-container\" align=\"center\">\n    <div class=\"flex-container\" align=\"center\">\n        <a href=\"https://img.shields.io/badge/Python-3.7%7C3.8%7C3.9%7C3.10-blue\">\n        <img src=\"https://img.shields.io/badge/Python-3.7%7C3.8%7C3.9%7C3.10-blue\"\n            alt=\"Python Version\">\n        <a href=\"https://github.com/psf/black\">\n        <img src=\"https://img.shields.io/badge/code%20style-black-000000.svg\"\n            alt=\"Format Version\">\n        <a href=\"https://codecov.io/gh/jwillis0720/sadie\">\n        <img src=\"https://codecov.io/gh/jwillis0720/sadie/branch/main/graph/badge.svg?token=EH9QEX4ZMP\"\n            alt=\"Code Coverage\">\n        <a href=\"https://github.com/pre-commit/pre-commit\">\n    </div>\n    <div class=\"flex-container\" align=\"center\">\n        <img src=\"https://img.shields.io/badge/pre--commit-enabled-brightgreen?logo=pre-commit&logoColor=white\"\n            alt=\"pre commit\">\n        <a href=\"https://pypi.org/project/sadie-antibody\">\n        <img src=\"https://img.shields.io/pypi/v/sadie-antibody?color=blue\"\n            alt='pypi'>\n        <a href=\"https://sadie.jordanrwillis.com\" >\n        <img src=\"https://api.netlify.com/api/v1/badges/59ff956c-82d9-4900-83c7-758ed21ccb34/deploy-status\"\n            alt=\"Documentation\">\n        </a>\n        <a href=\"https://github.com/jwillis0720/sadie/actions/workflows/docs.yml\" >\n        <img src=\"https://github.com/jwillis0720/sadie/actions/workflows/docs.yml/badge.svg\"\n            alt=\"Documentation\">\n        </a>\n    </div>\n    <div class=\"flex-container\" align=\"center\">\n        <a href=\"https://github.com/jwillis0720/sadie/workflows/Linux%20Build%20and%20Test/badge.svg\">\n        <img src=\"https://github.com/jwillis0720/sadie/workflows/Linux%20Build%20and%20Test/badge.svg\"\n            alt=\"Linux Build\">\n        <a href=\"https://github.com/jwillis0720/sadie/workflows/MacOS%20Build%20and%20Test/badge.svg\">\n        <img src=\"https://github.com/jwillis0720/sadie/workflows/MacOS%20Build%20and%20Test/badge.svg\"\n            alt=\"Mac Build\">\n        <a href=\"https://github.com/jwillis0720/sadie/actions/workflows/pyright.yml/badge.svg\">\n        <img src=\"https://github.com/jwillis0720/sadie/actions/workflows/pyright.yml/badge.svg\"\n            alt=\"Static Type\">\n    </div>\n</div>\n<!-- markdownlint-restore -->\n\n## About\n\n---\n\n<!-- use a href so you can use _blank to open new tab -->\n\n**Documentation**: <a href=\"https://sadie.jordanrwillis.com\" target=\"_blank\">https://sadie.jordanrwillis.com</a>\n\n**Source Code**: <a href=\"https://github.com/jwillis0720/sadie\" target=\"_blank\">https://github.com/jwillis0720/sadie</a>\n\n**Colab**: [https://colab.research.google.com/github/jwillis0720/sadie](https://colab.research.google.com/github/jwillis0720/sadie/blob/main/notebooks/airr_c/SADIE_DEMO.ipynb)\n\n---\n\nSADIE is the **S**equencing **A**nalysis and **D**ata library for **I**mmunoinformatics **E**xploration. The key feautures include:\n\n- Provide pre-built **command line applications** for popular immunoinformatics applications.\n\n- Provide a **low-level API framework** for immunoinformatics developers to build higher level tools.\n\n- Provide a **testable** and **reusable** library that WORKS!\n\n- Provide a **customizable** and **verified** germline reference library.\n\n- Maintain data formats consistent with standards governed by the [**AIRR community**](https://docs.airr-community.org/en/stable/#table-of-contents)\n\n- **Portability** ready to use out the box.\n\nSADIE is billed as a \"**complete antibody library**\", not because it aims to do everything, but because it aims to meet the needs of all immunoinformatics users. SADIE contains both low, mid and high level functionality for immunoinformatics tools and workflows. You can use SADIE as a framework to develop your own tools, use many of the prebuilt contributed tools, or run it in a notebook to enable data exploration. In addition, SADIE aims to port all code to python because relies heavily on the [Pandas](https://www.pandas.org) library, the workhorse of the data science/machine learning age.\n\n## Installation\n\n---\n\nInstallation is handled using the python package installer `pip`\n\n```console\n$ pip install sadie-antibody\n```\n\n### Development installation.\n\nPull requests are highly encouraged [here](https://github.com/jwillis0720/sadie/pulls). The development installation uses [pre-commit](https://pre-commit.com/), [flake8](https://flake8.pycqa.org/en/latest/) linting and [black](https://github.com/psf/black) style formatting to maintain code readability and reausability.\n\n```console\n$ git clone git@github.com/jwillis0720/sadie.git\n$ pip install poetry\n$ poetry install --with dev\n```\n\n## Quick Usage\n\nConsult the [documentation](https://sadie.jordanrwillis.com) for complete usage. Or checkout our [Colab](https://colab.research.google.com/github/jwillis0720/sadie/blob/main/notebooks/airr_c/SADIE_DEMO.ipynb) notebook\n\n### Command Line Usage\n\nAnnotate antibody sequences only from functional human imgt antibodies to a gzip output\n\n```console\n$ sadie airr my_sequence.fasta\n```\n\n### API\n\n```python\nfrom sadie.airr import Airr\n# define a single sequence\npg9_seq = \"\"\"\n    CAGCGATTAGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGTCGTCCCTGAGACTCTCCTGTGCAGCGT\n    CCGGATTCGACTTCAGTAGACAAGGCATGCACTGGGTCCGCCAGGCTCCAGGCCAGGGGCTGGAGTGGGT\n    GGCATTTATTAAATATGATGGAAGTGAGAAATATCATGCTGACTCCGTATGGGGCCGACTCAGCATCTCC\n    AGAGACAATTCCAAGGATACGCTTTATCTCCAAATGAATAGCCTGAGAGTCGAGGACACGGCTACATATT\n    TTTGTGTGAGAGAGGCTGGTGGGCCCGACTACCGTAATGGGTACAACTATTACGATTTCTATGATGGTTA\n    TTATAACTACCACTATATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCGAGC\"\"\".replace(\n    \"\\n\", \"\"\n)\n\n# initialize the api\nair_api = Airr(\"human\")\n\n# run single sequence string\nairr_table = air_api.run_single(\"PG9\", pg9_seq)\n```\n\n## License\n\n[![License](https://img.shields.io/github/license/jwillis0720/sadie)](https://opensource.org/licenses/MIT)\n\n- Copyright \u00a9 Jordan R. Willis, Troy M. Sincomb & Caleb K. Kibet\n",
    "bugtrack_url": null,
    "license": "MIT",
    "summary": "\"The Complete Antibody Library\"",
    "version": "1.0.6",
    "project_urls": {
        "Homepage": "https://sadie.jordanrwillis.com",
        "Repository": "https://github.com/jwillis0720/sadie",
        "issues": "https://github.com/jwillis0720/sadie/issues"
    },
    "split_keywords": [
        "antibody",
        "bioinformatics",
        "biology",
        "computational biology",
        "protein",
        "immunoinformatics"
    ],
    "urls": [
        {
            "comment_text": "",
            "digests": {
                "blake2b_256": "088ef5092381cab2eda2aaeb52ef3433cb870556e5c03449a8688df5fdb35bbf",
                "md5": "9b44989b2dff44671eb3fd02718b3fc1",
                "sha256": "2b0add4a6bb869ab057abf2efd01f8652a57c27bf2c7ce72399833b228908c67"
            },
            "downloads": -1,
            "filename": "sadie_antibody-1.0.6-py3-none-any.whl",
            "has_sig": false,
            "md5_digest": "9b44989b2dff44671eb3fd02718b3fc1",
            "packagetype": "bdist_wheel",
            "python_version": "py3",
            "requires_python": ">=3.8,<3.12",
            "size": 61808547,
            "upload_time": "2023-10-06T18:06:17",
            "upload_time_iso_8601": "2023-10-06T18:06:17.848502Z",
            "url": "https://files.pythonhosted.org/packages/08/8e/f5092381cab2eda2aaeb52ef3433cb870556e5c03449a8688df5fdb35bbf/sadie_antibody-1.0.6-py3-none-any.whl",
            "yanked": false,
            "yanked_reason": null
        },
        {
            "comment_text": "",
            "digests": {
                "blake2b_256": "18ee4a62f8c9f1a21e1ceef7169a790a5263a1ae8fa909e0958f18f3b58ffa0e",
                "md5": "1540edd12af77162a471f9394a05de46",
                "sha256": "f663ab76b3d6c83bebfff3dfc0819115094096c44edf4301ff2415340d01e286"
            },
            "downloads": -1,
            "filename": "sadie_antibody-1.0.6.tar.gz",
            "has_sig": false,
            "md5_digest": "1540edd12af77162a471f9394a05de46",
            "packagetype": "sdist",
            "python_version": "source",
            "requires_python": ">=3.8,<3.12",
            "size": 61450434,
            "upload_time": "2023-10-06T18:06:23",
            "upload_time_iso_8601": "2023-10-06T18:06:23.377204Z",
            "url": "https://files.pythonhosted.org/packages/18/ee/4a62f8c9f1a21e1ceef7169a790a5263a1ae8fa909e0958f18f3b58ffa0e/sadie_antibody-1.0.6.tar.gz",
            "yanked": false,
            "yanked_reason": null
        }
    ],
    "upload_time": "2023-10-06 18:06:23",
    "github": true,
    "gitlab": false,
    "bitbucket": false,
    "codeberg": false,
    "github_user": "jwillis0720",
    "github_project": "sadie",
    "travis_ci": false,
    "coveralls": false,
    "github_actions": true,
    "lcname": "sadie-antibody"
}
        
Elapsed time: 0.11561s